Incidental Mutation 'R0310:9530053A07Rik'
ID25148
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0310 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28142274 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 545 (V545L)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably benign
Transcript: ENSMUST00000059886
AA Change: V545L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: V545L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130693
Predicted Effect probably benign
Transcript: ENSMUST00000150948
AA Change: V545L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: V545L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Atad2 G A 15: 58,114,257 A499V probably damaging Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCTCTCACTTTACCTAAGGCTGGAAT -3'
(R):5'- CGAGGGTCAATGGCTTCTGCTCTAAT -3'

Sequencing Primer
(F):5'- GGTTTAGAGTGGTACCCGTACT -3'
(R):5'- AATCTGTTTACCCAAGTCATCACG -3'
Posted On2013-04-16