Incidental Mutation 'R2845:Gm13088'
ID251510
Institutional Source Beutler Lab
Gene Symbol Gm13088
Ensembl Gene ENSMUSG00000078513
Gene Namepredicted gene 13088
Synonyms
MMRRC Submission 040438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2845 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143653760-143657246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 143654298 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 385 (S385F)
Ref Sequence ENSEMBL: ENSMUSP00000101397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105771]
Predicted Effect probably damaging
Transcript: ENSMUST00000105771
AA Change: S385F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101397
Gene: ENSMUSG00000078513
AA Change: S385F

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 372 391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,380 R1412H probably damaging Het
Arhgap25 C T 6: 87,459,967 E634K possibly damaging Het
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cep152 A G 2: 125,587,974 I676T probably damaging Het
Cherp C A 8: 72,466,403 A449S probably damaging Het
Col19a1 C T 1: 24,559,681 G77E unknown Het
Csnk1g2 A G 10: 80,638,604 S220G probably damaging Het
Efcab7 T A 4: 99,909,638 V20D probably damaging Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Frem3 T C 8: 80,613,220 F714S probably damaging Het
Gpx6 A T 13: 21,318,875 probably null Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mrgpra2a T A 7: 47,427,130 M127L probably benign Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Plekhh3 T C 11: 101,170,230 probably benign Het
Psmd13 C A 7: 140,897,740 probably benign Het
Ptpru T A 4: 131,819,661 I168F probably benign Het
Sbf1 A G 15: 89,303,218 probably null Het
Skint10 T C 4: 112,715,826 S258G probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
Tas2r138 T C 6: 40,612,767 S182G probably benign Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zfp24 G T 18: 24,017,828 T87K probably damaging Het
Zfp407 G T 18: 84,558,397 C1530* probably null Het
Other mutations in Gm13088
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01418:Gm13088 APN 4 143655317 missense probably benign 0.00
IGL01551:Gm13088 APN 4 143656472 missense probably damaging 0.99
IGL02016:Gm13088 APN 4 143655319 missense possibly damaging 0.52
IGL02157:Gm13088 APN 4 143654377 missense probably damaging 1.00
IGL02433:Gm13088 APN 4 143655437 missense possibly damaging 0.92
IGL02726:Gm13088 APN 4 143655385 missense probably damaging 1.00
IGL02900:Gm13088 APN 4 143655515 missense possibly damaging 0.59
IGL03367:Gm13088 APN 4 143655623 missense possibly damaging 0.46
IGL02835:Gm13088 UTSW 4 143654247 missense probably damaging 1.00
R0141:Gm13088 UTSW 4 143654568 missense probably benign 0.01
R0166:Gm13088 UTSW 4 143654511 missense probably benign 0.00
R0197:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0365:Gm13088 UTSW 4 143655501 nonsense probably null
R0427:Gm13088 UTSW 4 143654423 missense probably benign 0.00
R0701:Gm13088 UTSW 4 143656440 missense possibly damaging 0.76
R0927:Gm13088 UTSW 4 143654220 missense possibly damaging 0.84
R1103:Gm13088 UTSW 4 143655372 missense probably damaging 1.00
R1163:Gm13088 UTSW 4 143656634 missense probably damaging 1.00
R1565:Gm13088 UTSW 4 143655617 nonsense probably null
R1588:Gm13088 UTSW 4 143655551 missense probably damaging 1.00
R1669:Gm13088 UTSW 4 143654346 missense possibly damaging 0.53
R1925:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R1929:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R1990:Gm13088 UTSW 4 143654268 missense probably damaging 1.00
R2272:Gm13088 UTSW 4 143654142 missense probably damaging 1.00
R3819:Gm13088 UTSW 4 143655795 missense probably benign 0.02
R4660:Gm13088 UTSW 4 143654277 missense probably benign 0.01
R4857:Gm13088 UTSW 4 143656588 missense possibly damaging 0.65
R4888:Gm13088 UTSW 4 143654401 missense probably benign 0.33
R5004:Gm13088 UTSW 4 143654136 missense probably benign
R5242:Gm13088 UTSW 4 143655611 missense probably benign 0.38
R5246:Gm13088 UTSW 4 143655557 missense probably benign 0.00
R5596:Gm13088 UTSW 4 143654455 missense probably damaging 1.00
R5735:Gm13088 UTSW 4 143654635 missense probably damaging 1.00
R5841:Gm13088 UTSW 4 143655539 missense possibly damaging 0.95
R5982:Gm13088 UTSW 4 143654464 missense probably damaging 0.99
R6052:Gm13088 UTSW 4 143655652 missense probably damaging 1.00
R6169:Gm13088 UTSW 4 143654115 missense probably benign 0.04
R6403:Gm13088 UTSW 4 143655773 nonsense probably null
R6584:Gm13088 UTSW 4 143655470 missense possibly damaging 0.74
R6898:Gm13088 UTSW 4 143655483 missense probably damaging 1.00
R7438:Gm13088 UTSW 4 143655560 missense probably damaging 0.96
R7563:Gm13088 UTSW 4 143654105 nonsense probably null
X0021:Gm13088 UTSW 4 143655748 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAACGTTGGGTCTCCAGATC -3'
(R):5'- ATATTTATGCCTTGAGCCTCTTGG -3'

Sequencing Primer
(F):5'- CGTTGGGTCTCCAGATCATAAAC -3'
(R):5'- TTTCTCCTTGAGAGTGTTAGACATAC -3'
Posted On2014-12-04