Incidental Mutation 'R2845:Tas2r138'
ID 251514
Institutional Source Beutler Lab
Gene Symbol Tas2r138
Ensembl Gene ENSMUSG00000058250
Gene Name taste receptor, type 2, member 138
Synonyms T2R138, mt2r31, Tas2r38
MMRRC Submission 040438-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2845 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 40589249-40590244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40589701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 182 (S182G)
Ref Sequence ENSEMBL: ENSMUSP00000075876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076565]
AlphaFold Q7TQA6
Predicted Effect probably benign
Transcript: ENSMUST00000076565
AA Change: S182G

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075876
Gene: ENSMUSG00000058250
AA Change: S182G

DomainStartEndE-ValueType
Pfam:TAS2R 11 315 3.8e-64 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane G protein-coupled receptor that controls the ability to taste glucosinolates, a family of bitter-tasting compounds found in plants of the Brassica sp. Synthetic compounds phenylthiocarbamide (PTC) and 6-n-propylthiouracil (PROP) have been identified as ligands for this receptor and have been used to test the genetic diversity of this gene. Although several allelic forms of this gene have been identified worldwide, there are two predominant common forms (taster and non-taster) found outside of Africa. These alleles differ at three nucleotide positions resulting in amino acid changes in the protein (A49P, A262V, and V296I) with the amino acid combination PAV identifying the taster variant (and AVI identifying the non-taster variant). [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap25 C T 6: 87,436,949 (GRCm39) E634K possibly damaging Het
Atg4a G A X: 139,893,589 (GRCm39) E106K probably benign Het
Bahd1 G A 2: 118,753,004 (GRCm39) R757H probably damaging Het
Cep152 A G 2: 125,429,894 (GRCm39) I676T probably damaging Het
Cherp C A 8: 73,220,247 (GRCm39) A449S probably damaging Het
Col19a1 C T 1: 24,598,762 (GRCm39) G77E unknown Het
Cplane1 G A 15: 8,245,864 (GRCm39) R1412H probably damaging Het
Csnk1g2 A G 10: 80,474,438 (GRCm39) S220G probably damaging Het
Efcab7 T A 4: 99,766,835 (GRCm39) V20D probably damaging Het
Fhad1 G T 4: 141,632,279 (GRCm39) Q1287K probably benign Het
Frem3 T C 8: 81,339,849 (GRCm39) F714S probably damaging Het
Gpx6 A T 13: 21,503,045 (GRCm39) probably null Het
Hsd3b1 T C 3: 98,760,094 (GRCm39) E299G probably damaging Het
Mark2 T C 19: 7,264,227 (GRCm39) E116G probably damaging Het
Mrgpra2a T A 7: 47,076,878 (GRCm39) M127L probably benign Het
Or10al3 T C 17: 38,011,714 (GRCm39) I51T probably damaging Het
Pign C A 1: 105,585,521 (GRCm39) L9F possibly damaging Het
Plekha1 G T 7: 130,510,095 (GRCm39) W280C probably damaging Het
Plekhh3 T C 11: 101,061,056 (GRCm39) probably benign Het
Pramel22 G A 4: 143,380,868 (GRCm39) S385F probably damaging Het
Psmd13 C A 7: 140,477,653 (GRCm39) probably benign Het
Ptpru T A 4: 131,546,972 (GRCm39) I168F probably benign Het
Sbf1 A G 15: 89,187,421 (GRCm39) probably null Het
Skint10 T C 4: 112,573,023 (GRCm39) S258G probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Ssh3 T C 19: 4,315,324 (GRCm39) Y338C probably damaging Het
Tgfbr3l A G 8: 4,299,280 (GRCm39) D49G probably damaging Het
Zbtb8os A T 4: 129,235,309 (GRCm39) E54D probably damaging Het
Zfp24 G T 18: 24,150,885 (GRCm39) T87K probably damaging Het
Zfp407 G T 18: 84,576,522 (GRCm39) C1530* probably null Het
Other mutations in Tas2r138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Tas2r138 APN 6 40,589,520 (GRCm39) missense probably benign 0.07
IGL01468:Tas2r138 APN 6 40,589,410 (GRCm39) missense probably benign 0.22
IGL02626:Tas2r138 APN 6 40,589,649 (GRCm39) missense possibly damaging 0.61
IGL03008:Tas2r138 APN 6 40,590,116 (GRCm39) missense probably damaging 1.00
R0595:Tas2r138 UTSW 6 40,589,799 (GRCm39) missense probably damaging 1.00
R2975:Tas2r138 UTSW 6 40,590,198 (GRCm39) missense probably benign 0.00
R4202:Tas2r138 UTSW 6 40,589,410 (GRCm39) missense possibly damaging 0.95
R4923:Tas2r138 UTSW 6 40,589,820 (GRCm39) missense possibly damaging 0.82
R5526:Tas2r138 UTSW 6 40,589,914 (GRCm39) missense probably benign 0.00
R6647:Tas2r138 UTSW 6 40,589,733 (GRCm39) missense possibly damaging 0.91
R6869:Tas2r138 UTSW 6 40,589,355 (GRCm39) missense probably damaging 1.00
R8781:Tas2r138 UTSW 6 40,589,850 (GRCm39) missense probably benign 0.00
R8786:Tas2r138 UTSW 6 40,589,611 (GRCm39) missense probably damaging 1.00
R9200:Tas2r138 UTSW 6 40,589,494 (GRCm39) missense probably damaging 1.00
R9258:Tas2r138 UTSW 6 40,590,129 (GRCm39) missense probably damaging 1.00
R9475:Tas2r138 UTSW 6 40,589,392 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAGATCAGAAATATGATGGCTCTG -3'
(R):5'- ACTGCTCCAAGATTGTCCGC -3'

Sequencing Primer
(F):5'- CTCTGATGTGGGCCTCAAG -3'
(R):5'- AAGATTGTCCGCTTCTCTCACAC -3'
Posted On 2014-12-04