Incidental Mutation 'R2846:Gal3st2c'
ID251563
Institutional Source Beutler Lab
Gene Symbol Gal3st2c
Ensembl Gene ENSMUSG00000073608
Gene Namegalactose-3-O-sulfotransferase 2C
SynonymsGm6086
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93990509-94017147 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93996400 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 8 (Q8L)
Ref Sequence ENSEMBL: ENSMUSP00000095234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097632]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097632
AA Change: Q8L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095234
Gene: ENSMUSG00000073608
AA Change: Q8L

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 382 8.4e-150 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Gal3st2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Gal3st2c APN 1 94009049 missense probably benign 0.38
IGL01469:Gal3st2c APN 1 94009317 missense probably benign 0.18
PIT4431001:Gal3st2c UTSW 1 94008112 missense probably damaging 1.00
R0110:Gal3st2c UTSW 1 94009497 missense probably benign 0.03
R0602:Gal3st2c UTSW 1 94009179 missense probably damaging 1.00
R0846:Gal3st2c UTSW 1 94006947 missense possibly damaging 0.51
R1577:Gal3st2c UTSW 1 94006928 missense probably damaging 0.98
R1900:Gal3st2c UTSW 1 94009044 missense probably damaging 1.00
R1902:Gal3st2c UTSW 1 94008889 missense probably damaging 1.00
R2143:Gal3st2c UTSW 1 94009451 nonsense probably null
R3737:Gal3st2c UTSW 1 94009328 missense possibly damaging 0.79
R4236:Gal3st2c UTSW 1 94008741 missense probably damaging 1.00
R4623:Gal3st2c UTSW 1 94009456 missense possibly damaging 0.59
R5177:Gal3st2c UTSW 1 94009208 nonsense probably null
R5590:Gal3st2c UTSW 1 94008301 critical splice donor site probably null
R7529:Gal3st2c UTSW 1 94009317 missense probably benign 0.18
R7559:Gal3st2c UTSW 1 94009353 missense probably damaging 1.00
Z1088:Gal3st2c UTSW 1 94008145 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAGTAGGTAAGCTTCCTAGGG -3'
(R):5'- AAAAGGCTCTCCTGTCCCAAG -3'

Sequencing Primer
(F):5'- AGCTTCCTAGGGATTTAAGTTCAG -3'
(R):5'- TCCTGTCCCAAGTGAAACTGG -3'
Posted On2014-12-04