Incidental Mutation 'R2508:Prdm1'
ID251568
Institutional Source Beutler Lab
Gene Symbol Prdm1
Ensembl Gene ENSMUSG00000038151
Gene NamePR domain containing 1, with ZNF domain
SynonymsBlimp1, b2b1765Clo, Blimp-1, PRDI-BF1
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location44437177-44528501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44446807 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 249 (T249S)
Ref Sequence ENSEMBL: ENSMUSP00000039248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]
Predicted Effect probably benign
Transcript: ENSMUST00000039174
AA Change: T249S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: T249S

DomainStartEndE-ValueType
SET 118 239 1.1e-19 SMART
low complexity region 359 393 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
ZnF_C2H2 606 628 6.42e-4 SMART
ZnF_C2H2 634 656 3.89e-3 SMART
ZnF_C2H2 662 684 7.26e-3 SMART
ZnF_C2H2 690 712 1.36e-2 SMART
ZnF_C2H2 718 738 1.12e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105490
AA Change: T216S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: T216S

DomainStartEndE-ValueType
SET 85 206 1.1e-19 SMART
low complexity region 326 360 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
ZnF_C2H2 573 595 6.42e-4 SMART
ZnF_C2H2 601 623 3.89e-3 SMART
ZnF_C2H2 629 651 7.26e-3 SMART
ZnF_C2H2 657 679 1.36e-2 SMART
ZnF_C2H2 685 705 1.12e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167340
Predicted Effect probably benign
Transcript: ENSMUST00000218369
AA Change: T231S

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r90 C T 17: 17,733,967 L798F probably damaging Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Prdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Prdm1 APN 10 44441892 missense probably damaging 1.00
IGL01331:Prdm1 APN 10 44441974 missense possibly damaging 0.67
IGL02064:Prdm1 APN 10 44441342 missense probably damaging 1.00
IGL02669:Prdm1 APN 10 44439884 missense probably benign 0.28
IGL02944:Prdm1 APN 10 44441811 missense probably benign
IGL03295:Prdm1 APN 10 44439870 missense probably damaging 0.99
PIT4576001:Prdm1 UTSW 10 44458508 start codon destroyed probably null 0.05
R0008:Prdm1 UTSW 10 44441679 missense probably damaging 1.00
R0166:Prdm1 UTSW 10 44440091 missense probably damaging 1.00
R0226:Prdm1 UTSW 10 44456696 missense probably benign 0.03
R0284:Prdm1 UTSW 10 44456626 missense probably damaging 1.00
R0398:Prdm1 UTSW 10 44439809 missense probably damaging 1.00
R1200:Prdm1 UTSW 10 44450130 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1438:Prdm1 UTSW 10 44442128 missense probably benign 0.00
R1519:Prdm1 UTSW 10 44439986 nonsense probably null
R1886:Prdm1 UTSW 10 44439758 missense probably damaging 0.99
R2070:Prdm1 UTSW 10 44441412 missense possibly damaging 0.82
R3087:Prdm1 UTSW 10 44446827 missense probably damaging 1.00
R3150:Prdm1 UTSW 10 44458492 unclassified probably null
R4165:Prdm1 UTSW 10 44441576 missense probably benign 0.11
R4490:Prdm1 UTSW 10 44446907 nonsense probably null
R4647:Prdm1 UTSW 10 44439690 missense probably damaging 0.98
R4911:Prdm1 UTSW 10 44442052 missense possibly damaging 0.90
R4925:Prdm1 UTSW 10 44440169 missense probably damaging 1.00
R5153:Prdm1 UTSW 10 44450225 missense possibly damaging 0.94
R5247:Prdm1 UTSW 10 44440102 missense probably damaging 1.00
R5792:Prdm1 UTSW 10 44450228 missense probably damaging 1.00
R6164:Prdm1 UTSW 10 44450195 missense probably damaging 1.00
R6247:Prdm1 UTSW 10 44446786 splice site probably null
R7196:Prdm1 UTSW 10 44456992 missense probably benign 0.14
R7270:Prdm1 UTSW 10 44441570 missense probably benign 0.07
Z1088:Prdm1 UTSW 10 44441925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAAAACAACATTCTGTACTGG -3'
(R):5'- TACGTGAATCCAGCTCACTCTG -3'

Sequencing Primer
(F):5'- TAAAGAATGTTTTTCCTCTTCCTCG -3'
(R):5'- TCTGCCCGGGAGCAAAAC -3'
Posted On2014-12-04