Incidental Mutation 'R2508:Vmn2r90'
ID251636
Institutional Source Beutler Lab
Gene Symbol Vmn2r90
Ensembl Gene ENSMUSG00000092120
Gene Namevomeronasal 2, receptor 90
SynonymsEG626942
MMRRC Submission 040414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R2508 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17703747-17735156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17733967 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 798 (L798F)
Ref Sequence ENSEMBL: ENSMUSP00000126650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169805] [ENSMUST00000231659] [ENSMUST00000232078] [ENSMUST00000232113]
Predicted Effect probably damaging
Transcript: ENSMUST00000169805
AA Change: L798F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126650
Gene: ENSMUSG00000092120
AA Change: L798F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-43 PFAM
Pfam:NCD3G 514 567 3e-22 PFAM
Pfam:7tm_3 600 835 9.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231940
Predicted Effect probably benign
Transcript: ENSMUST00000232078
Predicted Effect probably benign
Transcript: ENSMUST00000232113
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,393 T20I probably benign Het
Adamts2 C T 11: 50,788,689 T832I possibly damaging Het
Agbl1 G A 7: 76,589,550 probably null Het
Ankrd61 T C 5: 143,897,076 probably benign Het
Anpep T G 7: 79,838,291 Y506S possibly damaging Het
Aox2 T A 1: 58,343,673 H1037Q probably benign Het
Auh G A 13: 52,898,719 R47* probably null Het
B4galt5 T A 2: 167,306,638 M187L probably benign Het
Bub1 A T 2: 127,801,423 D1000E probably benign Het
Cacna1f T G X: 7,626,448 probably null Het
Cdh3 T C 8: 106,552,407 L667P probably damaging Het
Cenpe A T 3: 135,241,073 R1116S possibly damaging Het
Ces1b T A 8: 93,073,341 M136L possibly damaging Het
Cfap54 T C 10: 92,997,374 E1130G possibly damaging Het
Chd9 C T 8: 91,033,987 P2120L probably benign Het
Clu T C 14: 65,975,003 V135A probably damaging Het
Cmip T A 8: 117,436,693 S388T probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Cox4i1 T A 8: 120,673,290 V51E possibly damaging Het
Crym T C 7: 120,201,827 N33S probably benign Het
Ctcf T A 8: 105,671,384 V434E probably damaging Het
D430042O09Rik T A 7: 125,795,343 V197D probably benign Het
Daam1 G A 12: 71,975,223 D732N probably damaging Het
Dcaf13 A G 15: 39,145,152 Y383C probably benign Het
Dock2 T C 11: 34,312,485 T957A probably benign Het
Duox1 A G 2: 122,333,138 D817G probably benign Het
Fads3 A G 19: 10,056,454 Y401C probably damaging Het
Fam72a T C 1: 131,528,854 probably null Het
Fbxw21 C A 9: 109,145,485 K322N probably benign Het
Fdxr G A 11: 115,271,980 T100I probably damaging Het
Galnt11 C G 5: 25,247,612 P41A probably damaging Het
Glb1l T C 1: 75,201,829 T322A probably damaging Het
Gm6803 T C 12: 88,018,488 Y95C probably damaging Het
Gm6871 T A 7: 41,547,990 T149S probably benign Het
Gpr26 C T 7: 131,967,094 T56I probably damaging Het
Grik4 C A 9: 42,622,142 G361C probably damaging Het
Gsr T G 8: 33,680,288 D200E probably benign Het
Igsf5 T A 16: 96,364,047 D7E probably benign Het
Inpp5e T A 2: 26,399,343 I522F probably damaging Het
Insm2 C A 12: 55,600,311 T280K probably benign Het
Itih4 T C 14: 30,895,478 V585A probably damaging Het
Knl1 A T 2: 119,058,368 R17* probably null Het
Lag3 G T 6: 124,911,309 L15I possibly damaging Het
Lepr T A 4: 101,790,896 S861T probably damaging Het
Mcur1 A T 13: 43,544,465 Y320N probably damaging Het
Mgam A T 6: 40,759,783 D872V probably damaging Het
Mlycd T C 8: 119,407,707 probably null Het
Mpl C A 4: 118,455,757 C193F probably damaging Het
Mycbp2 C A 14: 103,131,245 A4142S probably damaging Het
Myh1 T A 11: 67,213,598 D993E possibly damaging Het
N4bp2 T A 5: 65,790,061 D11E probably benign Het
Neb T C 2: 52,195,521 I1521V probably benign Het
Notch1 A G 2: 26,465,473 V1744A possibly damaging Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1056 A G 2: 86,356,364 L6P possibly damaging Het
Olfr1181 T C 2: 88,423,456 T190A possibly damaging Het
Olfr798 T A 10: 129,625,915 I49L probably benign Het
Otogl A G 10: 107,874,500 L576P probably damaging Het
P2ry1 C T 3: 61,003,479 T13M probably damaging Het
Pak6 A T 2: 118,694,569 R559* probably null Het
Papd4 A G 13: 93,184,218 L109S probably damaging Het
Parvb A T 15: 84,297,970 M234L probably benign Het
Pcdha11 T C 18: 37,012,854 V666A possibly damaging Het
Pde3b T A 7: 114,526,857 Y775* probably null Het
Pgam5 A G 5: 110,266,003 L98P probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkib T G 10: 57,728,109 D4E probably damaging Het
Plcb1 A T 2: 135,260,508 I202F probably benign Het
Pold3 A G 7: 100,121,383 V14A probably damaging Het
Prdm1 T A 10: 44,446,807 T249S probably benign Het
Prpf39 T A 12: 65,057,815 F551L probably benign Het
Prune2 A G 19: 17,122,622 E1830G probably benign Het
Ralgapa1 G A 12: 55,718,201 P889S probably damaging Het
Rassf2 A T 2: 131,998,243 probably null Het
Rnf185 A G 11: 3,418,067 Y204H probably benign Het
Rpap1 A G 2: 119,780,054 probably null Het
Rufy3 T C 5: 88,649,898 S645P probably damaging Het
Scn11a T A 9: 119,765,529 Y1266F probably damaging Het
Senp7 T A 16: 56,151,362 H287Q probably benign Het
Sgsm3 T C 15: 81,003,872 probably null Het
Slc25a11 A T 11: 70,645,832 V104E possibly damaging Het
Slc25a13 G A 6: 6,117,190 T175I probably benign Het
Slc26a3 T A 12: 31,470,903 F702Y probably damaging Het
Smco2 T A 6: 146,859,967 L184H probably damaging Het
Ssc4d A T 5: 135,965,607 C90S probably damaging Het
Sspo T C 6: 48,464,364 S1835P probably damaging Het
Stk35 A G 2: 129,801,515 T140A probably damaging Het
Syngr1 C T 15: 80,111,740 T160M probably damaging Het
Tgfb1i1 A G 7: 128,248,913 probably null Het
Thoc1 T A 18: 9,977,947 V296E probably damaging Het
Timp2 C T 11: 118,310,586 C75Y probably damaging Het
Tlr1 T C 5: 64,925,296 Y646C probably damaging Het
Tprn G A 2: 25,268,928 E655K possibly damaging Het
Trbv14 A C 6: 41,135,490 I74L probably benign Het
Trbv5 T A 6: 41,062,621 Y53* probably null Het
Trpm5 T C 7: 143,088,919 Q97R possibly damaging Het
Tut1 A G 19: 8,955,567 D88G probably damaging Het
Ucp2 A T 7: 100,498,413 I200F probably benign Het
Unc45a G A 7: 80,338,875 S131L probably benign Het
Uty A T Y: 1,158,182 H573Q probably damaging Het
Vmn1r17 T A 6: 57,360,870 Y121F possibly damaging Het
Vmn1r53 T C 6: 90,223,572 I257V probably benign Het
Vmn2r94 A T 17: 18,257,474 M225K probably benign Het
Wdr24 A T 17: 25,824,299 I32F possibly damaging Het
Zc3h11a T A 1: 133,624,783 T529S probably benign Het
Zc3h4 A G 7: 16,434,339 H791R unknown Het
Zfp24 A G 18: 24,017,870 L73P probably damaging Het
Zfp616 T C 11: 74,083,295 I130T probably benign Het
Zim1 ACAGCAG ACAGCAGCAG 7: 6,677,430 probably benign Het
Zim1 CAG CAGAAG 7: 6,677,431 probably benign Het
Other mutations in Vmn2r90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vmn2r90 APN 17 17733496 missense probably benign 0.00
IGL01330:Vmn2r90 APN 17 17733280 missense probably benign 0.00
IGL01989:Vmn2r90 APN 17 17713232 nonsense probably null
IGL02080:Vmn2r90 APN 17 17712858 missense probably damaging 1.00
IGL02112:Vmn2r90 APN 17 17712203 missense probably damaging 0.98
IGL02123:Vmn2r90 APN 17 17733482 missense probably benign 0.01
IGL02749:Vmn2r90 APN 17 17726860 makesense probably null
IGL03114:Vmn2r90 APN 17 17733509 missense probably damaging 1.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0132:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0184:Vmn2r90 UTSW 17 17726877 nonsense probably null
R0379:Vmn2r90 UTSW 17 17728139 missense probably damaging 1.00
R1022:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1024:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1897:Vmn2r90 UTSW 17 17733304 missense probably damaging 1.00
R1993:Vmn2r90 UTSW 17 17713263 missense probably damaging 1.00
R2472:Vmn2r90 UTSW 17 17728146 missense probably damaging 1.00
R2679:Vmn2r90 UTSW 17 17712869 missense possibly damaging 0.46
R3409:Vmn2r90 UTSW 17 17733376 missense probably benign 0.00
R4693:Vmn2r90 UTSW 17 17733694 missense possibly damaging 0.91
R4797:Vmn2r90 UTSW 17 17712305 missense probably damaging 1.00
R5258:Vmn2r90 UTSW 17 17712852 missense probably benign 0.12
R5358:Vmn2r90 UTSW 17 17704150 critical splice donor site probably null
R5445:Vmn2r90 UTSW 17 17734124 missense probably benign 0.04
R5446:Vmn2r90 UTSW 17 17712202 missense probably damaging 0.99
R5567:Vmn2r90 UTSW 17 17712074 missense probably damaging 1.00
R5680:Vmn2r90 UTSW 17 17726772 missense possibly damaging 0.93
R5686:Vmn2r90 UTSW 17 17713450 missense probably benign 0.02
R5751:Vmn2r90 UTSW 17 17733866 missense probably damaging 0.96
R6156:Vmn2r90 UTSW 17 17733344 missense probably benign 0.01
R6185:Vmn2r90 UTSW 17 17733382 missense probably damaging 1.00
R6450:Vmn2r90 UTSW 17 17733236 missense possibly damaging 0.47
R6707:Vmn2r90 UTSW 17 17728102 missense probably damaging 1.00
R6802:Vmn2r90 UTSW 17 17712089 missense probably damaging 1.00
R6913:Vmn2r90 UTSW 17 17704061 missense probably damaging 1.00
R7070:Vmn2r90 UTSW 17 17704051 missense probably damaging 0.98
R7237:Vmn2r90 UTSW 17 17703987 missense possibly damaging 0.92
Z1088:Vmn2r90 UTSW 17 17733617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAAGGGTTCAGCAGTTGC -3'
(R):5'- GTGGCACTACTTTCAACCATAG -3'

Sequencing Primer
(F):5'- AGGGTTCAGCAGTTGCCTTCC -3'
(R):5'- AACCACTATTCCTTTTTGAATGGG -3'
Posted On2014-12-04