Incidental Mutation 'R2509:Cacna1c'
ID251731
Institutional Source Beutler Lab
Gene Symbol Cacna1c
Ensembl Gene ENSMUSG00000051331
Gene Namecalcium channel, voltage-dependent, L type, alpha 1C subunit
SynonymsCav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit, L-type Cav1.2
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118587240-119196418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118734982 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 261 (D261V)
Ref Sequence ENSEMBL: ENSMUSP00000151863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075591] [ENSMUST00000078320] [ENSMUST00000112790] [ENSMUST00000112793] [ENSMUST00000112825] [ENSMUST00000185345] [ENSMUST00000186889] [ENSMUST00000187317] [ENSMUST00000187386] [ENSMUST00000187474] [ENSMUST00000187940] [ENSMUST00000188078] [ENSMUST00000188106] [ENSMUST00000188522] [ENSMUST00000188865] [ENSMUST00000189389] [ENSMUST00000189520] [ENSMUST00000190285] [ENSMUST00000219018] [ENSMUST00000219223] [ENSMUST00000219833] [ENSMUST00000220022]
Predicted Effect probably damaging
Transcript: ENSMUST00000075591
AA Change: D420V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075021
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 3.5e-60 PFAM
PDB:4DEY|B 246 369 2e-57 PDB
low complexity region 370 384 N/A INTRINSIC
transmembrane domain 390 409 N/A INTRINSIC
Pfam:Ion_trans 424 618 1.3e-46 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
Pfam:Ion_trans 801 1031 2.6e-51 PFAM
Pfam:PKD_channel 1095 1348 2.7e-10 PFAM
Pfam:Ion_trans 1119 1341 3.9e-70 PFAM
Blast:EFh 1362 1390 4e-9 BLAST
Ca_chan_IQ 1476 1510 3.28e-15 SMART
low complexity region 1630 1640 N/A INTRINSIC
low complexity region 1810 1824 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078320
AA Change: D420V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077433
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 1.4e-59 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 5.2e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 2.5e-51 PFAM
Pfam:PKD_channel 1070 1323 1.1e-9 PFAM
Pfam:Ion_trans 1094 1316 1.5e-69 PFAM
Blast:EFh 1337 1365 4e-9 BLAST
Ca_chan_IQ 1451 1485 3.28e-15 SMART
low complexity region 1605 1615 N/A INTRINSIC
low complexity region 1785 1799 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112790
AA Change: D420V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108410
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 5.7e-60 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 2.1e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 1e-51 PFAM
Pfam:Ion_trans 1094 1305 1.1e-66 PFAM
Pfam:PKD_channel 1140 1312 1.3e-8 PFAM
Blast:EFh 1326 1354 4e-9 BLAST
Ca_chan_IQ 1440 1474 3.28e-15 SMART
low complexity region 1594 1604 N/A INTRINSIC
low complexity region 1774 1788 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112793
AA Change: D420V

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108413
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
Pfam:Ion_trans 1 257 1.8e-64 PFAM
Pfam:PKD_channel 379 624 5.8e-8 PFAM
Pfam:Ion_trans 389 630 5e-56 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
Pfam:Ion_trans 765 1043 8.7e-64 PFAM
Pfam:Ion_trans 1084 1411 6.4e-69 PFAM
Pfam:PKD_channel 1234 1406 9.2e-9 PFAM
Pfam:GPHH 1413 1482 7.7e-40 PFAM
Ca_chan_IQ 1534 1568 3.28e-15 SMART
Pfam:CAC1F_C 1577 2060 3.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112825
AA Change: D156V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108444
Gene: ENSMUSG00000051331
AA Change: D156V

DomainStartEndE-ValueType
Pfam:Ion_trans 1 140 1.8e-31 PFAM
PDB:4DEY|B 141 264 1e-54 PDB
low complexity region 265 279 N/A INTRINSIC
Pfam:Ion_trans 319 513 2e-46 PFAM
low complexity region 528 538 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 606 613 N/A INTRINSIC
Pfam:Ion_trans 659 906 1e-43 PFAM
Pfam:Ion_trans 994 1205 7.1e-70 PFAM
Pfam:PKD_channel 1041 1212 1.6e-8 PFAM
Blast:EFh 1226 1254 4e-9 BLAST
Ca_chan_IQ 1340 1374 3.28e-15 SMART
low complexity region 1494 1504 N/A INTRINSIC
low complexity region 1674 1688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185345
AA Change: D420V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140833
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 3e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.2e-50 PFAM
Pfam:PKD_channel 1250 1502 6.9e-9 PFAM
Pfam:Ion_trans 1273 1495 6.4e-65 PFAM
Blast:EFh 1516 1544 5e-9 BLAST
Ca_chan_IQ 1630 1664 2.5e-19 SMART
low complexity region 1784 1794 N/A INTRINSIC
low complexity region 1964 1978 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186889
AA Change: D450V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140056
Gene: ENSMUSG00000051331
AA Change: D450V

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 1.5e-59 PFAM
PDB:4DEY|B 435 533 5e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 5.6e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 2.7e-51 PFAM
Pfam:PKD_channel 1261 1512 1.3e-9 PFAM
Pfam:Ion_trans 1283 1505 1.7e-69 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187317
AA Change: D420V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140693
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.8e-60 PFAM
PDB:4DEY|B 405 503 2e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.3e-50 PFAM
Pfam:PKD_channel 1249 1530 8.3e-8 PFAM
Pfam:Ion_trans 1273 1326 5e-16 PFAM
Pfam:Ion_trans 1323 1523 2.5e-56 PFAM
Blast:EFh 1544 1572 5e-9 BLAST
Ca_chan_IQ 1658 1692 2.5e-19 SMART
low complexity region 1812 1822 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187386
AA Change: D391V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140341
Gene: ENSMUSG00000051331
AA Change: D391V

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Pfam:Ion_trans 132 375 8.5e-60 PFAM
PDB:4DEY|B 376 499 1e-57 PDB
low complexity region 500 514 N/A INTRINSIC
transmembrane domain 520 539 N/A INTRINSIC
Pfam:Ion_trans 554 748 1.4e-44 PFAM
low complexity region 763 773 N/A INTRINSIC
low complexity region 793 805 N/A INTRINSIC
low complexity region 841 848 N/A INTRINSIC
transmembrane domain 892 914 N/A INTRINSIC
Pfam:Ion_trans 931 1161 2.9e-49 PFAM
Pfam:PKD_channel 1226 1478 6.8e-9 PFAM
Pfam:Ion_trans 1249 1471 6.3e-65 PFAM
Blast:EFh 1492 1520 4e-9 BLAST
Ca_chan_IQ 1606 1640 2.5e-19 SMART
low complexity region 1760 1770 N/A INTRINSIC
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187474
AA Change: D450V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140961
Gene: ENSMUSG00000051331
AA Change: D450V

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1261 1512 7.3e-10 PFAM
Pfam:Ion_trans 1283 1505 8.3e-70 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187940
AA Change: D450V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141033
Gene: ENSMUSG00000051331
AA Change: D450V

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1260 1512 5.8e-11 PFAM
Pfam:Ion_trans 1283 1505 1.2e-66 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188078
AA Change: D420V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140415
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 9e-8 PFAM
Pfam:Ion_trans 1253 1475 4.3e-68 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188106
AA Change: D420V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140886
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-62 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-46 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-51 PFAM
Pfam:Ion_trans 1278 1489 5.2e-70 PFAM
Pfam:PKD_channel 1325 1496 4.8e-9 PFAM
Blast:EFh 1510 1538 5e-9 BLAST
Ca_chan_IQ 1624 1658 3.28e-15 SMART
low complexity region 1778 1788 N/A INTRINSIC
low complexity region 1958 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188181
Predicted Effect probably damaging
Transcript: ENSMUST00000188522
AA Change: D420V

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140920
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
transmembrane domain 549 568 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-44 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-49 PFAM
Pfam:PKD_channel 1255 1507 7e-9 PFAM
Pfam:Ion_trans 1278 1500 6.4e-65 PFAM
Blast:EFh 1521 1549 5e-9 BLAST
Ca_chan_IQ 1635 1669 2.5e-19 SMART
low complexity region 1789 1799 N/A INTRINSIC
low complexity region 1969 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000188865
AA Change: D420V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139981
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 6.8e-9 PFAM
Pfam:Ion_trans 1253 1475 6.3e-65 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189389
AA Change: D420V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139855
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 3e-49 PFAM
Pfam:PKD_channel 1229 1510 8.2e-8 PFAM
Pfam:Ion_trans 1253 1306 5e-16 PFAM
Pfam:Ion_trans 1303 1503 2.5e-56 PFAM
Blast:EFh 1524 1552 5e-9 BLAST
Ca_chan_IQ 1638 1672 2.5e-19 SMART
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189520
AA Change: D420V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140220
Gene: ENSMUSG00000051331
AA Change: D420V

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 7e-50 PFAM
Pfam:PKD_channel 1229 1499 2.2e-9 PFAM
Pfam:Ion_trans 1253 1305 6.6e-16 PFAM
Pfam:Ion_trans 1301 1492 1.1e-56 PFAM
Blast:EFh 1513 1541 5e-9 BLAST
Ca_chan_IQ 1627 1661 2.5e-19 SMART
low complexity region 1781 1791 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190285
AA Change: D450V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141015
Gene: ENSMUSG00000051331
AA Change: D450V

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Ion_trans 191 434 4e-58 PFAM
PDB:4DEY|B 435 558 2e-57 PDB
low complexity region 559 573 N/A INTRINSIC
transmembrane domain 579 598 N/A INTRINSIC
Pfam:Ion_trans 613 807 1.5e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 900 907 N/A INTRINSIC
transmembrane domain 951 973 N/A INTRINSIC
Pfam:Ion_trans 990 1220 3e-49 PFAM
Pfam:PKD_channel 1285 1537 1.4e-7 PFAM
Pfam:Ion_trans 1308 1530 4.4e-68 PFAM
Blast:EFh 1551 1579 5e-9 BLAST
Ca_chan_IQ 1665 1699 2.5e-19 SMART
low complexity region 1819 1829 N/A INTRINSIC
low complexity region 1999 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219018
AA Change: D261V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219223
AA Change: D261V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219833
AA Change: D261V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220022
AA Change: D261V

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene do not survive to term. Selective ablation in beta cells resulted in impaired insulin secretion and systemic glucose intolerance. Heterozygotes were hypoactive, showed increased anxiety, and poor motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Cacna1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cacna1c APN 6 118676444 splice site probably benign
IGL00990:Cacna1c APN 6 118613295 missense probably damaging 1.00
IGL01352:Cacna1c APN 6 118656557 nonsense probably null
IGL01922:Cacna1c APN 6 118652668 missense probably damaging 0.99
IGL02008:Cacna1c APN 6 118715924 missense probably null 0.25
IGL02049:Cacna1c APN 6 118603919 missense probably benign 0.34
IGL02320:Cacna1c APN 6 118637792 missense probably damaging 1.00
IGL02375:Cacna1c APN 6 118675923 missense probably damaging 1.00
IGL02454:Cacna1c APN 6 118602180 missense probably damaging 1.00
IGL02544:Cacna1c APN 6 118751479 missense probably damaging 1.00
IGL02648:Cacna1c APN 6 118757496 missense probably damaging 1.00
IGL03191:Cacna1c APN 6 118741903 missense probably damaging 1.00
PIT4418001:Cacna1c UTSW 6 118654423 missense
PIT4469001:Cacna1c UTSW 6 118595972 missense unknown
R0041:Cacna1c UTSW 6 118594027 missense probably damaging 0.99
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0083:Cacna1c UTSW 6 118625523 missense probably damaging 1.00
R0131:Cacna1c UTSW 6 118625512 missense probably damaging 1.00
R0142:Cacna1c UTSW 6 118603882 missense probably damaging 1.00
R0193:Cacna1c UTSW 6 118602402 splice site probably benign
R0245:Cacna1c UTSW 6 118604454 missense probably benign 0.10
R0394:Cacna1c UTSW 6 118625497 missense probably damaging 1.00
R0555:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0617:Cacna1c UTSW 6 118602213 missense probably damaging 1.00
R0652:Cacna1c UTSW 6 118602229 missense probably damaging 1.00
R0730:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0812:Cacna1c UTSW 6 118630263 missense probably benign 0.07
R0828:Cacna1c UTSW 6 118757386 missense probably benign 0.24
R0837:Cacna1c UTSW 6 118630270 nonsense probably null
R0881:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0882:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0924:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R0930:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R1157:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1158:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1159:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1160:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1237:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1238:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1239:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1337:Cacna1c UTSW 6 118627455 missense probably damaging 1.00
R1433:Cacna1c UTSW 6 118652793 nonsense probably null
R1463:Cacna1c UTSW 6 118593994 missense probably benign 0.27
R1517:Cacna1c UTSW 6 118598759 missense probably benign 0.01
R1619:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1704:Cacna1c UTSW 6 118602146 missense probably benign 0.01
R1739:Cacna1c UTSW 6 118610544 missense probably damaging 0.99
R1804:Cacna1c UTSW 6 118687046 missense probably damaging 1.00
R1889:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1891:Cacna1c UTSW 6 118776519 missense probably damaging 1.00
R1895:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1944:Cacna1c UTSW 6 118606266 missense probably damaging 1.00
R1961:Cacna1c UTSW 6 118630322 missense probably benign 0.05
R2043:Cacna1c UTSW 6 118596088 missense probably benign 0.01
R2045:Cacna1c UTSW 6 118656137 missense probably damaging 1.00
R2217:Cacna1c UTSW 6 118670407 missense probably damaging 1.00
R2237:Cacna1c UTSW 6 118652743 missense possibly damaging 0.94
R3157:Cacna1c UTSW 6 118751524 missense probably benign 0.00
R3739:Cacna1c UTSW 6 118741952 missense probably benign
R3831:Cacna1c UTSW 6 118604463 missense probably benign 0.06
R4319:Cacna1c UTSW 6 118654369 missense probably damaging 1.00
R4477:Cacna1c UTSW 6 118630239 missense possibly damaging 0.48
R4571:Cacna1c UTSW 6 118630380 missense probably benign
R4671:Cacna1c UTSW 6 118652058 missense probably damaging 1.00
R4729:Cacna1c UTSW 6 118656175 missense probably damaging 1.00
R4741:Cacna1c UTSW 6 118613310 missense probably damaging 1.00
R4798:Cacna1c UTSW 6 118630302 nonsense probably null
R4803:Cacna1c UTSW 6 118751541 missense probably damaging 0.99
R4821:Cacna1c UTSW 6 118696425 missense probably damaging 1.00
R4888:Cacna1c UTSW 6 118751439 missense probably damaging 1.00
R4981:Cacna1c UTSW 6 118751471 missense probably benign 0.00
R5253:Cacna1c UTSW 6 118597969 missense probably benign 0.01
R5297:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5345:Cacna1c UTSW 6 118656536 critical splice donor site probably null
R5364:Cacna1c UTSW 6 118656543 missense probably benign 0.35
R5439:Cacna1c UTSW 6 118654372 missense probably damaging 1.00
R5472:Cacna1c UTSW 6 118638446 missense possibly damaging 0.86
R5516:Cacna1c UTSW 6 119057218 missense probably damaging 1.00
R5590:Cacna1c UTSW 6 118687182 missense probably damaging 1.00
R5619:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5684:Cacna1c UTSW 6 118687044 missense probably damaging 1.00
R5737:Cacna1c UTSW 6 118741932 missense probably damaging 1.00
R5768:Cacna1c UTSW 6 118697680 missense probably damaging 1.00
R5933:Cacna1c UTSW 6 118612580 missense probably damaging 1.00
R5965:Cacna1c UTSW 6 118602300 missense probably damaging 1.00
R6114:Cacna1c UTSW 6 118596140 missense probably benign 0.07
R6161:Cacna1c UTSW 6 119057302 missense probably damaging 1.00
R6267:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6267:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6296:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6296:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6307:Cacna1c UTSW 6 118613953 missense probably damaging 0.97
R6431:Cacna1c UTSW 6 118751373 missense probably damaging 1.00
R6467:Cacna1c UTSW 6 118652710 missense probably damaging 1.00
R7026:Cacna1c UTSW 6 118637771 missense probably damaging 1.00
R7049:Cacna1c UTSW 6 118601163 missense probably benign 0.35
R7072:Cacna1c UTSW 6 118596106 missense
R7192:Cacna1c UTSW 6 118656249 missense
R7243:Cacna1c UTSW 6 118637729 critical splice donor site probably null
R7250:Cacna1c UTSW 6 118598005 missense
R7250:Cacna1c UTSW 6 118696451 missense
R7264:Cacna1c UTSW 6 118602195 missense
R7312:Cacna1c UTSW 6 119057211 missense
R7392:Cacna1c UTSW 6 118741920 missense
R7401:Cacna1c UTSW 6 119052708 critical splice acceptor site probably null
X0065:Cacna1c UTSW 6 118657376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAAACACTGTCGCCTGG -3'
(R):5'- CTTCTGGAAGTGAACACAGAAC -3'

Sequencing Primer
(F):5'- AAACACTGTCGCCTGGCTCTC -3'
(R):5'- TAGCGGTCTGTAGAAAGGGC -3'
Posted On2014-12-04