Incidental Mutation 'R2847:Rnf43'
ID251743
Institutional Source Beutler Lab
Gene Symbol Rnf43
Ensembl Gene ENSMUSG00000034177
Gene Namering finger protein 43
Synonyms
MMRRC Submission 040440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2847 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87662722-87735539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87732267 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 731 (N731K)
Ref Sequence ENSEMBL: ENSMUSP00000130685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040089] [ENSMUST00000092800] [ENSMUST00000121782] [ENSMUST00000165679]
Predicted Effect probably benign
Transcript: ENSMUST00000040089
AA Change: N604K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000044241
Gene: ENSMUSG00000034177
AA Change: N604K

DomainStartEndE-ValueType
PDB:4KNG|F 1 71 7e-32 PDB
transmembrane domain 72 91 N/A INTRINSIC
RING 145 185 6.43e-8 SMART
low complexity region 337 351 N/A INTRINSIC
low complexity region 366 376 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 491 516 N/A INTRINSIC
low complexity region 646 654 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092800
AA Change: N731K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090476
Gene: ENSMUSG00000034177
AA Change: N731K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121782
AA Change: N690K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112748
Gene: ENSMUSG00000034177
AA Change: N690K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 157 6e-54 PDB
transmembrane domain 158 177 N/A INTRINSIC
RING 231 271 6.43e-8 SMART
low complexity region 423 437 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 577 602 N/A INTRINSIC
low complexity region 732 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162740
Predicted Effect probably benign
Transcript: ENSMUST00000165679
AA Change: N731K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130685
Gene: ENSMUSG00000034177
AA Change: N731K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PDB:4KNG|F 44 198 6e-93 PDB
transmembrane domain 199 218 N/A INTRINSIC
RING 272 312 6.43e-8 SMART
low complexity region 464 478 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 547 558 N/A INTRINSIC
low complexity region 618 643 N/A INTRINSIC
low complexity region 773 781 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RING-type E3 ubiquitin ligase and is predicted to contain a transmembrane domain, a protease-associated domain, an ectodomain, and a cytoplasmic RING domain. This protein is thought to negatively regulate Wnt signaling, and expression of this gene results in an increase in ubiquitination of frizzled receptors, an alteration in their subcellular distribution, resulting in reduced surface levels of these receptors. Mutations in this gene have been reported in multiple tumor cells, including colorectal and endometrial cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930510E17Rik T C 9: 53,264,789 noncoding transcript Het
Abca13 T C 11: 9,294,584 V2149A possibly damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
Bub3 C T 7: 131,570,884 T326M possibly damaging Het
Cd151 T C 7: 141,469,550 Y57H probably damaging Het
Cib4 T C 5: 30,488,588 N112S probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Defb39 C T 8: 19,052,893 R62H possibly damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Efcab12 A G 6: 115,811,111 I630T probably damaging Het
Erc2 T C 14: 28,040,488 V736A probably damaging Het
Fbf1 C T 11: 116,157,688 probably null Het
Fndc9 C T 11: 46,238,041 A129V probably damaging Het
Foxk2 CGGGGGG CGGGGGGGGG 11: 121,260,491 probably benign Het
Gba2 T C 4: 43,568,000 probably null Het
Gna12 T A 5: 140,785,593 D61V probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Grin2b C A 6: 135,740,953 V714L probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itgb6 T C 2: 60,600,535 T772A probably damaging Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Mme T A 3: 63,345,199 N421K possibly damaging Het
Mmp1b C T 9: 7,370,763 V331I probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nav1 G C 1: 135,450,644 probably null Het
Nln A G 13: 104,025,025 M679T probably damaging Het
Olfr353 A G 2: 36,890,524 L108P probably damaging Het
Olfr920 C T 9: 38,756,036 T116I possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pax7 T C 4: 139,779,643 D361G possibly damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Plekhh2 G T 17: 84,597,966 R1096L probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Robo4 C T 9: 37,404,476 R342* probably null Het
Sec23ip G A 7: 128,754,073 V307I probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
St5 T C 7: 109,525,337 Q1099R probably damaging Het
Tas1r3 T A 4: 155,860,202 Q854L probably benign Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trpm4 A G 7: 45,310,598 F771S probably damaging Het
Tstd3 A T 4: 21,759,375 F132L possibly damaging Het
Ulk2 T C 11: 61,824,729 probably null Het
Unc13b T C 4: 43,180,404 Y3080H probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vmn2r60 A T 7: 42,136,433 H220L probably benign Het
Vps13a A G 19: 16,703,599 S1078P probably damaging Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zdhhc22 T A 12: 86,988,562 T39S probably benign Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Rnf43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Rnf43 APN 11 87731892 missense probably benign 0.15
IGL01520:Rnf43 APN 11 87664716 missense probably damaging 1.00
IGL01541:Rnf43 APN 11 87730220 missense probably null 1.00
IGL01784:Rnf43 APN 11 87731806 missense possibly damaging 0.56
IGL02037:Rnf43 APN 11 87731653 missense probably benign 0.00
IGL02725:Rnf43 APN 11 87731585 missense probably damaging 1.00
IGL03062:Rnf43 APN 11 87732304 nonsense probably null
R0226:Rnf43 UTSW 11 87731437 missense probably damaging 1.00
R0391:Rnf43 UTSW 11 87731282 missense possibly damaging 0.86
R0834:Rnf43 UTSW 11 87731251 missense probably benign
R1163:Rnf43 UTSW 11 87729513 missense probably damaging 0.98
R1203:Rnf43 UTSW 11 87727475 splice site probably benign
R1314:Rnf43 UTSW 11 87732319 missense probably benign
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1404:Rnf43 UTSW 11 87734177 missense possibly damaging 0.82
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1469:Rnf43 UTSW 11 87731407 missense probably damaging 1.00
R1511:Rnf43 UTSW 11 87731347 missense probably benign 0.00
R1513:Rnf43 UTSW 11 87729431 missense probably damaging 1.00
R1614:Rnf43 UTSW 11 87731659 nonsense probably null
R1615:Rnf43 UTSW 11 87731659 nonsense probably null
R2341:Rnf43 UTSW 11 87732025 missense probably damaging 0.96
R2410:Rnf43 UTSW 11 87732259 missense possibly damaging 0.94
R2849:Rnf43 UTSW 11 87732267 missense probably benign 0.04
R5567:Rnf43 UTSW 11 87727445 missense probably damaging 1.00
R5943:Rnf43 UTSW 11 87731735 missense probably damaging 1.00
R6135:Rnf43 UTSW 11 87732125 missense probably damaging 1.00
R6452:Rnf43 UTSW 11 87732253 missense probably damaging 1.00
R6511:Rnf43 UTSW 11 87732163 missense probably benign 0.01
R7426:Rnf43 UTSW 11 87731852 missense probably benign 0.03
R7528:Rnf43 UTSW 11 87732128 missense probably benign 0.00
X0064:Rnf43 UTSW 11 87727342 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGACTGTGCACACTGCTTGC -3'
(R):5'- CCTATGACTTCTGTGCTTCAGG -3'

Sequencing Primer
(F):5'- ACACTGCTTGCCCGGTTTTC -3'
(R):5'- GTGCTTCAGGTAAGTTATAATCTCC -3'
Posted On2014-12-04