Incidental Mutation 'R2509:Shank1'
ID251747
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene NameSH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44310253-44360572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44352123 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1089 (A1089T)
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
Predicted Effect unknown
Transcript: ENSMUST00000107934
AA Change: A1080T
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: A1080T

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107935
AA Change: A1081T
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: A1081T

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: A1089T
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: A1089T

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154776
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44354238 missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44354236 missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44353123 missense possibly damaging 0.93
IGL01347:Shank1 APN 7 44342120 missense unknown
IGL01621:Shank1 APN 7 44342465 missense unknown
IGL01621:Shank1 APN 7 44351599 missense unknown
IGL01964:Shank1 APN 7 44325678 missense unknown
IGL02309:Shank1 APN 7 44312842 missense unknown
IGL02325:Shank1 APN 7 44327080 nonsense probably null
IGL02387:Shank1 APN 7 44356937 missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44354473 missense possibly damaging 0.59
R0098:Shank1 UTSW 7 44313285 missense unknown
R0098:Shank1 UTSW 7 44313285 missense unknown
R0197:Shank1 UTSW 7 44352294 missense unknown
R0326:Shank1 UTSW 7 44319170 missense unknown
R0365:Shank1 UTSW 7 44353977 missense possibly damaging 0.89
R0883:Shank1 UTSW 7 44352294 missense unknown
R1033:Shank1 UTSW 7 44356796 missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44357038 missense probably damaging 1.00
R1453:Shank1 UTSW 7 44316075 missense unknown
R1594:Shank1 UTSW 7 44327223 nonsense probably null
R1713:Shank1 UTSW 7 44319737 missense unknown
R1783:Shank1 UTSW 7 44352737 missense possibly damaging 0.70
R1869:Shank1 UTSW 7 44342115 nonsense probably null
R1870:Shank1 UTSW 7 44342115 nonsense probably null
R1959:Shank1 UTSW 7 44325377 missense unknown
R1962:Shank1 UTSW 7 44344323 critical splice donor site probably null
R2406:Shank1 UTSW 7 44356952 missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44351724 missense unknown
R3877:Shank1 UTSW 7 44344992 missense unknown
R4041:Shank1 UTSW 7 44342162 missense unknown
R4249:Shank1 UTSW 7 44319736 missense unknown
R4303:Shank1 UTSW 7 44342474 missense unknown
R4431:Shank1 UTSW 7 44319652 nonsense probably null
R4525:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4642:Shank1 UTSW 7 44313141 missense unknown
R4722:Shank1 UTSW 7 44313214 nonsense probably null
R4805:Shank1 UTSW 7 44343711 missense unknown
R4874:Shank1 UTSW 7 44316073 missense unknown
R4904:Shank1 UTSW 7 44334040 intron probably benign
R4939:Shank1 UTSW 7 44326162 missense unknown
R5394:Shank1 UTSW 7 44352651 missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44351822 missense unknown
R5556:Shank1 UTSW 7 44344315 intron probably benign
R5620:Shank1 UTSW 7 44312736 missense unknown
R5656:Shank1 UTSW 7 44352886 missense probably benign 0.33
R5688:Shank1 UTSW 7 44354487 missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44353740 missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44356816 missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44357206 missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44352566 missense probably benign 0.18
R6245:Shank1 UTSW 7 44352253 missense unknown
R6500:Shank1 UTSW 7 44327221 missense unknown
R6602:Shank1 UTSW 7 44352336 missense probably benign 0.03
R6655:Shank1 UTSW 7 44327220 missense unknown
R6709:Shank1 UTSW 7 44354176 missense probably benign 0.43
R6734:Shank1 UTSW 7 44353686 missense probably benign 0.01
R6881:Shank1 UTSW 7 44351793 missense unknown
R6902:Shank1 UTSW 7 44356815 missense probably benign 0.39
R6975:Shank1 UTSW 7 44313106 splice site probably null
R6985:Shank1 UTSW 7 44344913 missense unknown
R7072:Shank1 UTSW 7 44344946 missense unknown
R7116:Shank1 UTSW 7 44327161 missense unknown
R7117:Shank1 UTSW 7 44327161 missense unknown
R7199:Shank1 UTSW 7 44353140 missense possibly damaging 0.86
R7249:Shank1 UTSW 7 44327161 missense unknown
R7252:Shank1 UTSW 7 44327161 missense unknown
R7552:Shank1 UTSW 7 44353028 missense not run
R7653:Shank1 UTSW 7 44319669 missense unknown
X0019:Shank1 UTSW 7 44356928 missense probably damaging 1.00
X0065:Shank1 UTSW 7 44351929 missense unknown
Z1088:Shank1 UTSW 7 44352166 missense unknown
Predicted Primers PCR Primer
(F):5'- ATATCACAGTGGCGCCCTAC -3'
(R):5'- CTGCTACTGGTAGATGGGGC -3'

Sequencing Primer
(F):5'- ATCACCATGCGCATCCTC -3'
(R):5'- GATGGAATTTTTCTCCGACGGCC -3'
Posted On2014-12-04