Incidental Mutation 'R2509:4930571K23Rik'
List |< first << previous [record 90 of 1920] next >> last >|
ID251758
Institutional Source Beutler Lab
Gene Symbol 4930571K23Rik
Ensembl Gene ENSMUSG00000090457
Gene NameRIKEN cDNA 4930571K23 gene
Synonyms
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location125368861-125371013 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to A at 125369139 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166958
SMART Domains Protein: ENSMUSP00000132505
Gene: ENSMUSG00000090457

DomainStartEndE-ValueType
Pfam:DUF4694 1 151 1.2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206013
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in 4930571K23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1697:4930571K23Rik UTSW 7 125369029 exon noncoding transcript
R2510:4930571K23Rik UTSW 7 125369139 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATCAGGGAGGCATTGTTCTC -3'
(R):5'- AGGTTGTCCTTGCTGCACTC -3'

Sequencing Primer
(F):5'- GGAGGCATTGTTCTCCCACC -3'
(R):5'- ACTCCCCGTCGGCTTCATAG -3'
Posted On2014-12-04