Incidental Mutation 'R2509:Tmc8'
ID251821
Institutional Source Beutler Lab
Gene Symbol Tmc8
Ensembl Gene ENSMUSG00000050106
Gene Nametransmembrane channel-like gene family 8
SynonymsEver2, EVIN2
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R2509 (G1)
Quality Score150
Status Validated
Chromosome11
Chromosomal Location117782076-117793110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117792685 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 689 (T689A)
Ref Sequence ENSEMBL: ENSMUSP00000113628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050874] [ENSMUST00000106331] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050874
AA Change: T688A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106
AA Change: T688A

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106331
SMART Domains Protein: ENSMUSP00000101938
Gene: ENSMUSG00000025573

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ig_3 31 100 6.1e-5 PFAM
Pfam:Ig_3 120 195 1.2e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106334
AA Change: T689A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106
AA Change: T689A

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117781
AA Change: T688A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106
AA Change: T688A

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119455
AA Change: T689A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106
AA Change: T689A

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156458
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Tmc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Tmc8 APN 11 117786504 missense probably damaging 1.00
IGL01098:Tmc8 APN 11 117792563 missense possibly damaging 0.47
IGL01403:Tmc8 APN 11 117791074 missense possibly damaging 0.94
IGL01526:Tmc8 APN 11 117792084 splice site probably benign
IGL02045:Tmc8 APN 11 117786520 missense probably damaging 1.00
IGL02138:Tmc8 APN 11 117791255 missense probably benign 0.01
IGL02581:Tmc8 APN 11 117783888 missense probably benign 0.01
IGL02685:Tmc8 APN 11 117792574 missense probably damaging 0.96
R0241:Tmc8 UTSW 11 117786381 unclassified probably benign
R0485:Tmc8 UTSW 11 117792078 splice site probably benign
R1168:Tmc8 UTSW 11 117792563 missense possibly damaging 0.47
R1701:Tmc8 UTSW 11 117791362 splice site probably null
R2425:Tmc8 UTSW 11 117792569 missense probably damaging 0.96
R4747:Tmc8 UTSW 11 117792724 missense probably benign 0.27
R4783:Tmc8 UTSW 11 117791605 splice site probably null
R5821:Tmc8 UTSW 11 117792629 nonsense probably null
R5923:Tmc8 UTSW 11 117783812 missense probably damaging 1.00
R6381:Tmc8 UTSW 11 117791600 missense probably null 0.73
R6712:Tmc8 UTSW 11 117784813 missense probably benign 0.43
R7351:Tmc8 UTSW 11 117783828 missense probably damaging 1.00
R7493:Tmc8 UTSW 11 117784932 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCGTGGGTTTTGGCTACAAC -3'
(R):5'- GGAGCCATCTGTATGCAGTG -3'

Sequencing Primer
(F):5'- GGGTTTTGGCTACAACTTCTAAC -3'
(R):5'- GGCAGAGATTGTGGGCC -3'
Posted On2014-12-04