Incidental Mutation 'R2509:Cmya5'
ID251837
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93093558 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1674 (Q1674R)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: Q1674R

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: Q1674R

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thbs2 A G 17: 14,685,843 V265A probably benign Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4824:Cmya5 UTSW 13 93093574 missense probably benign 0.04
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTCAGTTGTCACAAATGG -3'
(R):5'- GCCTGAGAAGCACAAACAGTTATC -3'

Sequencing Primer
(F):5'- CACAAATGGCTTGGGTTGCTCC -3'
(R):5'- CAGTTATCAGAAGTACCAACTGC -3'
Posted On2014-12-04