Incidental Mutation 'R2848:Il12rb1'
ID251852
Institutional Source Beutler Lab
Gene Symbol Il12rb1
Ensembl Gene ENSMUSG00000000791
Gene Nameinterleukin 12 receptor, beta 1
SynonymsIL-12R[b], CD212
MMRRC Submission 040441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2848 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70808449-70821424 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70815802 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 396 (W396*)
Ref Sequence ENSEMBL: ENSMUSP00000148279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000808] [ENSMUST00000212146] [ENSMUST00000212657]
Predicted Effect probably null
Transcript: ENSMUST00000000808
AA Change: W396*
SMART Domains Protein: ENSMUSP00000000808
Gene: ENSMUSG00000000791
AA Change: W396*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 467 550 9.4e-7 SMART
transmembrane domain 567 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211936
Predicted Effect probably benign
Transcript: ENSMUST00000212146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212251
Predicted Effect probably null
Transcript: ENSMUST00000212657
AA Change: W396*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212826
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased serum IFN-gamma levels in response to recombinant IL-12 or LPS treatment, and failure of ConA-activated splenocytes to proliferate or secrete IFN-gamma in response to IL-12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik A T 7: 126,830,722 F101Y possibly damaging Het
A230050P20Rik A T 9: 20,873,572 H225L probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adamts14 T A 10: 61,218,435 Q606L probably damaging Het
Adgrf5 C A 17: 43,422,640 N118K possibly damaging Het
Baz2b A T 2: 59,924,666 Y1073N possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cntnap5c A T 17: 57,876,392 D31V probably damaging Het
Cobl A G 11: 12,378,342 L81P probably damaging Het
Cpsf1 A T 15: 76,602,851 L209Q probably damaging Het
Crocc G A 4: 141,018,756 A1684V probably damaging Het
Cyp4f37 T A 17: 32,629,125 C206S probably damaging Het
Diexf A T 1: 193,128,451 N81K probably benign Het
Dnah3 A G 7: 119,967,938 V2355A probably benign Het
Dnah6 T C 6: 73,129,331 K1756E probably benign Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Gpr37 C T 6: 25,666,946 probably benign Het
Grin2a A G 16: 9,761,965 F145L possibly damaging Het
Htr4 T C 18: 62,428,126 S153P probably damaging Het
Igkv9-120 T A 6: 68,050,144 probably benign Het
Itga8 A T 2: 12,160,404 V798D probably damaging Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mgam C A 6: 40,652,715 A86E possibly damaging Het
Myh4 A G 11: 67,248,633 N592S probably benign Het
Naa16 A G 14: 79,335,883 C816R probably damaging Het
Nek8 A G 11: 78,168,141 S513P probably damaging Het
Ociad1 A G 5: 73,294,351 probably null Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr350 A G 2: 36,850,799 Y251C probably damaging Het
Olfr721-ps1 C T 14: 14,407,398 P57S probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdh7 G A 5: 57,720,276 G391E probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Peg10 C T 6: 4,756,912 probably benign Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppargc1a A G 5: 51,473,809 F493L probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tectb C G 19: 55,180,999 probably benign Het
Try5 C T 6: 41,313,476 V25I probably benign Het
Ttn G T 2: 76,919,207 Q3833K probably benign Het
Usp53 G A 3: 122,934,491 P814L probably benign Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn2r114 A T 17: 23,290,974 M844K probably benign Het
Vwa8 G T 14: 78,947,142 R360L probably benign Het
Xlr4b A T X: 73,215,332 Q25L probably null Het
Zfp532 T A 18: 65,656,626 H1045Q possibly damaging Het
Zfp985 G A 4: 147,583,011 W112* probably null Het
Other mutations in Il12rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Il12rb1 APN 8 70811187 nonsense probably null
IGL03065:Il12rb1 APN 8 70820558 missense possibly damaging 0.51
P0026:Il12rb1 UTSW 8 70812541 missense probably damaging 0.99
R0140:Il12rb1 UTSW 8 70819771 splice site probably benign
R0763:Il12rb1 UTSW 8 70813290 splice site probably benign
R1554:Il12rb1 UTSW 8 70813372 critical splice donor site probably null
R1577:Il12rb1 UTSW 8 70810606 missense probably damaging 0.99
R1688:Il12rb1 UTSW 8 70819402 missense probably damaging 1.00
R1918:Il12rb1 UTSW 8 70813680 missense probably benign 0.04
R3735:Il12rb1 UTSW 8 70817218 missense probably damaging 0.99
R4791:Il12rb1 UTSW 8 70813368 missense possibly damaging 0.83
R4857:Il12rb1 UTSW 8 70810588 missense possibly damaging 0.94
R5189:Il12rb1 UTSW 8 70811058 missense possibly damaging 0.66
R5493:Il12rb1 UTSW 8 70809839 missense probably benign 0.00
R5590:Il12rb1 UTSW 8 70813767 missense possibly damaging 0.83
R6484:Il12rb1 UTSW 8 70809704 unclassified probably null
R7213:Il12rb1 UTSW 8 70816453 missense probably benign 0.00
R7301:Il12rb1 UTSW 8 70813699 missense possibly damaging 0.73
R7388:Il12rb1 UTSW 8 70810627 missense probably damaging 1.00
X0061:Il12rb1 UTSW 8 70814635 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGATTATCACTGACATGCTGGTG -3'
(R):5'- TTATCTGCCATCGTGTGACCTG -3'

Sequencing Primer
(F):5'- ACATGCTGGTGAGCCCTTGTAC -3'
(R):5'- TGCAGGCCACAGCATTC -3'
Posted On2014-12-04