Incidental Mutation 'R2509:Thbs2'
ID251859
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission 040415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R2509 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14685843 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 265 (V265A)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: V265A

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: V265A

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,406,453 I497V probably benign Het
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Abca17 G T 17: 24,289,613 probably benign Het
Ablim1 C T 19: 57,152,359 R196Q probably damaging Het
Acot11 T C 4: 106,755,319 I379V possibly damaging Het
Acot4 G A 12: 84,041,873 G165D probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ahctf1 T C 1: 179,770,693 S945G possibly damaging Het
Akr1c13 C T 13: 4,198,584 R263C probably damaging Het
Arfgap1 T A 2: 180,974,053 probably benign Het
Arhgef3 A G 14: 27,379,676 K103R probably damaging Het
Cabp1 A T 5: 115,172,784 N211K probably damaging Het
Cacna1c T A 6: 118,734,982 D261V probably damaging Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cast T C 13: 74,737,616 I277V probably benign Het
Cenpj T C 14: 56,532,237 K1165R probably null Het
Cenpk A G 13: 104,234,167 probably null Het
Cmya5 T C 13: 93,093,558 Q1674R probably benign Het
Cnnm1 T A 19: 43,441,886 V481D probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 G A 19: 40,090,569 V119I probably benign Het
Dnah7b A G 1: 46,195,287 T1460A probably damaging Het
Dnah8 G A 17: 30,775,045 D3379N probably benign Het
Dnajc4 C T 19: 6,990,743 R55H probably damaging Het
Ebf4 C T 2: 130,306,562 R98* probably null Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Ercc8 T C 13: 108,183,717 probably benign Het
Exo1 T C 1: 175,905,833 F75S probably damaging Het
Fam168a G T 7: 100,834,184 probably null Het
Fat3 G A 9: 15,925,014 R4065W possibly damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Gpr156 A G 16: 37,947,787 R22G probably benign Het
Greb1 A G 12: 16,724,922 V158A probably damaging Het
Grin2c T A 11: 115,251,068 K842* probably null Het
Hnf4a T A 2: 163,566,241 L329Q probably damaging Het
Hsp90ab1 A G 17: 45,569,341 L92P probably damaging Het
Ido1 T A 8: 24,584,485 R290* probably null Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift172 T C 5: 31,262,968 N1108S probably benign Het
Igkv3-9 T A 6: 70,588,744 M109K probably benign Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Iqck T G 7: 118,876,282 M98R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krtap1-3 C T 11: 99,590,827 E165K unknown Het
Lair1 A G 7: 4,010,783 L155P probably damaging Het
Mast4 G T 13: 102,853,842 S57Y probably damaging Het
Mical3 T C 6: 121,034,157 H360R probably damaging Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Nck2 T A 1: 43,554,233 V200E probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1214 T G 2: 88,987,431 Y257S probably damaging Het
Olfr1271 T C 2: 90,265,686 Y248C possibly damaging Het
Olfr1282 C T 2: 111,335,731 V116I probably damaging Het
Olfr1313 T A 2: 112,072,492 L30F probably benign Het
Olfr1453 T A 19: 13,027,694 I212F probably damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr870 A G 9: 20,171,229 L114P probably damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pask T A 1: 93,330,763 I288F possibly damaging Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Ppp1r16b A G 2: 158,761,463 Y436C possibly damaging Het
Prkca T C 11: 107,979,206 Y37C probably damaging Het
Rad18 T G 6: 112,675,922 H238P possibly damaging Het
Rap1b T A 10: 117,818,539 Q1L probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rpl3l A T 17: 24,732,386 D87V possibly damaging Het
Scrn2 T C 11: 97,033,166 V292A possibly damaging Het
Sdad1 A G 5: 92,305,825 Y35H probably benign Het
Sez6l2 T C 7: 126,953,772 S177P probably benign Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Shank1 T C 7: 44,351,724 S956P unknown Het
Shank1 G A 7: 44,352,123 A1089T unknown Het
Shprh G A 10: 11,166,724 C817Y probably damaging Het
Spata22 C T 11: 73,345,767 P300S probably damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stom C T 2: 35,320,342 A217T probably damaging Het
Stpg1 T C 4: 135,536,649 V341A probably benign Het
Tagap A G 17: 7,928,754 T99A probably benign Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Thyn1 A G 9: 27,000,020 R3G possibly damaging Het
Tia1 T A 6: 86,424,330 probably null Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmc8 A G 11: 117,792,685 T689A possibly damaging Het
Tmem11 A T 11: 60,864,981 probably null Het
Tmem55b A T 14: 50,929,658 Y129* probably null Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tnik T C 3: 28,667,915 V1310A probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim8 C T 19: 46,515,295 P429S probably benign Het
Ttc25 T G 11: 100,553,535 L222R probably damaging Het
Ttn C A 2: 76,857,412 probably benign Het
Ulk2 T C 11: 61,787,514 Y793C probably benign Het
Vill G A 9: 119,070,302 V337M possibly damaging Het
Vps53 C A 11: 76,066,835 V364F possibly damaging Het
Wdr66 A G 5: 123,256,106 K353E probably benign Het
Zan A T 5: 137,456,586 I1396N unknown Het
Zfa-ps A C 10: 52,544,243 noncoding transcript Het
Zfp426 T C 9: 20,470,681 T337A possibly damaging Het
Zfp536 T C 7: 37,567,978 E671G possibly damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1791:Thbs2 UTSW 17 14685813 missense probably benign
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAAGTATTGGTCCCCAGAGGC -3'
(R):5'- CAGCTTACAGTTGCAAGCC -3'

Sequencing Primer
(F):5'- TCTGGTGAGGCTGCCAGAG -3'
(R):5'- TACAGTTGCAAGCCTGACTC -3'
Posted On2014-12-04