Incidental Mutation 'R2510:Kcnh7'
ID251892
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.225) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62721917 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 910 (D910G)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: D910G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: D910G

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCATGGAGTCTGGTTGC -3'
(R):5'- CCTCAAGAGATAATAAGCCTGATTC -3'

Sequencing Primer
(F):5'- GCTTTCACCATTCTTGGAGTAGAATC -3'
(R):5'- ACTACATAAACTCATTCTTGCTTGTC -3'
Posted On2014-12-04