Incidental Mutation 'R2849:Agpat2'
ID251914
Institutional Source Beutler Lab
Gene Symbol Agpat2
Ensembl Gene ENSMUSG00000026922
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)
SynonymsBSCL1, 2510002J07Rik, LPAAT-beta
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26593057-26604417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26597239 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 109 (I109T)
Ref Sequence ENSEMBL: ENSMUSP00000115059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000100290] [ENSMUST00000102907] [ENSMUST00000139801] [ENSMUST00000149789] [ENSMUST00000150404] [ENSMUST00000152988] [ENSMUST00000154753] [ENSMUST00000166920] [ENSMUST00000174066] [ENSMUST00000174211]
Predicted Effect probably damaging
Transcript: ENSMUST00000028286
AA Change: I94T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922
AA Change: I94T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
PlsC 92 207 5.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100290
SMART Domains Protein: ENSMUSP00000097863
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.5e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102907
SMART Domains Protein: ENSMUSP00000099971
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 32 98 5.6e-21 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131940
Predicted Effect probably benign
Transcript: ENSMUST00000139801
SMART Domains Protein: ENSMUSP00000123465
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 6.9e-20 PFAM
low complexity region 101 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140508
Predicted Effect probably benign
Transcript: ENSMUST00000149789
Predicted Effect probably benign
Transcript: ENSMUST00000150404
SMART Domains Protein: ENSMUSP00000115482
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152988
Predicted Effect probably damaging
Transcript: ENSMUST00000154753
AA Change: I109T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115059
Gene: ENSMUSG00000026922
AA Change: I109T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Acyltransferase 92 129 1.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166920
SMART Domains Protein: ENSMUSP00000128741
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173777
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174211
SMART Domains Protein: ENSMUSP00000134034
Gene: ENSMUSG00000026921

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174465
Predicted Effect probably benign
Transcript: ENSMUST00000174656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of white and brown adipose tissue, insulin resistance, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Agpat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03412:Agpat2 APN 2 26593661 missense probably benign 0.02
R2302:Agpat2 UTSW 2 26604195 missense possibly damaging 0.90
R5151:Agpat2 UTSW 2 26597206 missense probably damaging 1.00
R6378:Agpat2 UTSW 2 26596135 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCTTGGGAAATAGCCAAAGTGG -3'
(R):5'- TTCTGTGTGCCCAAGTGTCC -3'

Sequencing Primer
(F):5'- TAGCCAAAGTGGTGCAGTCCTG -3'
(R):5'- AAGTGTCCTGTCCTGTGCCTG -3'
Posted On2014-12-04