Incidental Mutation 'R0311:Asprv1'
ID25193
Institutional Source Beutler Lab
Gene Symbol Asprv1
Ensembl Gene ENSMUSG00000033508
Gene Nameaspartic peptidase, retroviral-like 1
SynonymsTaps, SASPase, TPA-induced aspartic proteinase-like, SASP, 2300003P22Rik
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86628164-86629710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86628840 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 223 (W223R)
Ref Sequence ENSEMBL: ENSMUSP00000046121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043400]
Predicted Effect probably damaging
Transcript: ENSMUST00000043400
AA Change: W223R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046121
Gene: ENSMUSG00000033508
AA Change: W223R

DomainStartEndE-ValueType
Pfam:Asp_protease 177 295 1.3e-8 PFAM
Pfam:Asp_protease_2 196 286 1.6e-10 PFAM
low complexity region 314 338 N/A INTRINSIC
Meta Mutation Damage Score 0.692 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null allele develop fine skin wrinkles at the side of their body without any apparent epidermal differentiation defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Asprv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02186:Asprv1 APN 6 86628918 missense probably damaging 0.99
quince UTSW 6 86628840 missense probably damaging 1.00
R0254:Asprv1 UTSW 6 86629095 missense probably damaging 1.00
R1538:Asprv1 UTSW 6 86628636 nonsense probably null
R1661:Asprv1 UTSW 6 86628736 missense probably damaging 0.97
R1792:Asprv1 UTSW 6 86628372 missense possibly damaging 0.59
R2964:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2965:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R2966:Asprv1 UTSW 6 86628366 missense probably damaging 0.98
R4748:Asprv1 UTSW 6 86628423 missense probably damaging 0.98
R5600:Asprv1 UTSW 6 86629062 nonsense probably null
R5655:Asprv1 UTSW 6 86628482 missense probably benign 0.05
R5704:Asprv1 UTSW 6 86628550 missense probably damaging 1.00
R5715:Asprv1 UTSW 6 86628614 missense probably benign
R6259:Asprv1 UTSW 6 86628379 missense probably benign 0.05
R6899:Asprv1 UTSW 6 86628760 missense probably damaging 1.00
R7451:Asprv1 UTSW 6 86628948 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCAACCATTGGGATCATGCCAC -3'
(R):5'- CAGAAACTCGGCCTTCAGCTTTGTC -3'

Sequencing Primer
(F):5'- GGATGTCTACAATGGACTCAGTTCC -3'
(R):5'- CTTGCCCAGGCTAATTTCTGTG -3'
Posted On2013-04-16