Incidental Mutation 'R2849:Fis1'
ID251937
Institutional Source Beutler Lab
Gene Symbol Fis1
Ensembl Gene ENSMUSG00000019054
Gene Namefission, mitochondrial 1
SynonymsTtc11
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136953275-136966234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136963117 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 55 (I55T)
Ref Sequence ENSEMBL: ENSMUSP00000019198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000019198] [ENSMUST00000111093] [ENSMUST00000111094] [ENSMUST00000111097]
PDB Structure
Solution structure of RSGI RUH-001, a Fis1p-like and CGI-135 homologous domain from a mouse cDNA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000001790
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000019198
AA Change: I55T

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019198
Gene: ENSMUSG00000019054
AA Change: I55T

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 33 65 2.3e-18 PFAM
Pfam:Fis1_TPR_C 71 123 2.1e-27 PFAM
low complexity region 124 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111093
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111094
AA Change: I48T

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106723
Gene: ENSMUSG00000019054
AA Change: I48T

DomainStartEndE-ValueType
Pfam:Fis1_TPR_N 25 59 3.1e-20 PFAM
Pfam:Fis1_TPR_C 64 116 6.1e-28 PFAM
low complexity region 117 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111097
SMART Domains Protein: ENSMUSP00000106726
Gene: ENSMUSG00000019054

DomainStartEndE-ValueType
Pfam:Fis1_TPR_C 21 73 1.4e-28 PFAM
low complexity region 74 97 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152658
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The balance between fission and fusion regulates the morphology of mitochondria. TTC11 is a component of a mitochondrial complex that promotes mitochondrial fission (James et al., 2003 [PubMed 12783892]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Odf3 A G 7: 140,849,269 T156A probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Fis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Fis1 APN 5 136965974 missense probably benign 0.38
R0650:Fis1 UTSW 5 136962194 missense probably damaging 0.98
R1077:Fis1 UTSW 5 136965146 missense probably damaging 1.00
R1920:Fis1 UTSW 5 136965607 missense probably benign 0.07
R2848:Fis1 UTSW 5 136963117 missense possibly damaging 0.91
R4678:Fis1 UTSW 5 136963097 missense possibly damaging 0.67
R5410:Fis1 UTSW 5 136965566 missense probably damaging 1.00
R6229:Fis1 UTSW 5 136965674 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCAGACATCAAGTTAGCTGGAG -3'
(R):5'- AATGACTGTTCAGATGCTGGG -3'

Sequencing Primer
(F):5'- CATCAAGTTAGCTGGAGAATGATTGC -3'
(R):5'- CGTAGAGAATCAATCTAGCCCTTTC -3'
Posted On2014-12-04