Incidental Mutation 'R2510:Gpi1'
ID251954
Institutional Source Beutler Lab
Gene Symbol Gpi1
Ensembl Gene ENSMUSG00000036427
Gene Nameglucose phosphate isomerase 1
Synonymsneuroleukin, MF, Gpi-1t, Gpi-1s, Gpi-1r, maturation factor, Org, NK, NK/GPI, Gpi-1, AMF, Gpi1-t, Gpi1-s, Gpi1-r, autocrine motility factor
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location34201330-34230336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34205923 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 359 (S359P)
Ref Sequence ENSEMBL: ENSMUSP00000049355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038027] [ENSMUST00000205870] [ENSMUST00000205983] [ENSMUST00000206415]
PDB Structure
Crystal structure of mouse phosphoglucose isomerase [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with glucose 6-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with erythrose 4-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse AMF [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / phosphate complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / E4P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / A5P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / S6P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / 6PG complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / F6P complex [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000038027
AA Change: S359P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049355
Gene: ENSMUSG00000036427
AA Change: S359P

DomainStartEndE-ValueType
Pfam:PGI 54 546 1e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135243
Predicted Effect probably benign
Transcript: ENSMUST00000205800
Predicted Effect probably benign
Transcript: ENSMUST00000205865
Predicted Effect silent
Transcript: ENSMUST00000205870
Predicted Effect probably benign
Transcript: ENSMUST00000205983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206232
Predicted Effect probably benign
Transcript: ENSMUST00000206415
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for null mutations fail to develop beyond the egg cylinder stage and die by embryonic day 9.5. Homozygotes for a hypomorphic mutation exhibit nonspherocytic hemolytic anemia with hepatosplenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Gpi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Gpi1 APN 7 34215950 intron probably benign
IGL01911:Gpi1 APN 7 34220922 missense probably damaging 1.00
IGL02155:Gpi1 APN 7 34230189 missense possibly damaging 0.94
R0019:Gpi1 UTSW 7 34220899 missense probably damaging 0.99
R1413:Gpi1 UTSW 7 34230155 missense probably benign 0.22
R1974:Gpi1 UTSW 7 34220803 intron probably null
R2132:Gpi1 UTSW 7 34205914 missense probably damaging 1.00
R2254:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2255:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2435:Gpi1 UTSW 7 34205829 missense probably damaging 1.00
R2509:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R3408:Gpi1 UTSW 7 34202679 missense probably damaging 0.99
R5059:Gpi1 UTSW 7 34207688 missense probably damaging 1.00
R5141:Gpi1 UTSW 7 34227096 intron probably benign
R5272:Gpi1 UTSW 7 34220690 missense probably damaging 1.00
R5980:Gpi1 UTSW 7 34228926 critical splice donor site probably null
R6261:Gpi1 UTSW 7 34220745 missense possibly damaging 0.93
R6788:Gpi1 UTSW 7 34228990 missense probably damaging 1.00
R6835:Gpi1 UTSW 7 34227138 missense possibly damaging 0.89
R6989:Gpi1 UTSW 7 34202520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCATGGAAGCTACCCAAG -3'
(R):5'- TCGTGGTCCTTACAGTAGTCTTTAG -3'

Sequencing Primer
(F):5'- GCCACTACCCTAAGCAGGAGG -3'
(R):5'- CCTTACAGTAGTCTTTAGCAGAAAGC -3'
Posted On2014-12-04