Incidental Mutation 'R2849:Odf3'
ID251963
Institutional Source Beutler Lab
Gene Symbol Odf3
Ensembl Gene ENSMUSG00000025482
Gene Nameouter dense fiber of sperm tails 3
Synonyms1700011O04Rik, SHIPPO1
MMRRC Submission 040442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2849 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140847805-140851018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140849269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 156 (T156A)
Ref Sequence ENSEMBL: ENSMUSP00000101664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026555] [ENSMUST00000026557] [ENSMUST00000035300] [ENSMUST00000106049] [ENSMUST00000209690]
Predicted Effect probably benign
Transcript: ENSMUST00000026555
AA Change: T130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026555
Gene: ENSMUSG00000025482
AA Change: T130A

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 25 59 3.8e-3 PFAM
Pfam:SHIPPO-rpt 65 95 7.8e-2 PFAM
Pfam:SHIPPO-rpt 100 131 1.2e-7 PFAM
Pfam:SHIPPO-rpt 136 170 3.9e-4 PFAM
Pfam:SHIPPO-rpt 179 209 3e-4 PFAM
Pfam:SHIPPO-rpt 215 245 9.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026557
SMART Domains Protein: ENSMUSP00000026557
Gene: ENSMUSG00000025484

DomainStartEndE-ValueType
Pfam:SNARE 20 82 3.4e-13 PFAM
transmembrane domain 87 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035300
SMART Domains Protein: ENSMUSP00000048722
Gene: ENSMUSG00000038801

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 30 91 1.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106049
AA Change: T156A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101664
Gene: ENSMUSG00000025482
AA Change: T156A

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 126 157 9.4e-6 PFAM
Pfam:SHIPPO-rpt 162 196 1e-3 PFAM
Pfam:SHIPPO-rpt 241 271 7.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190581
Predicted Effect probably benign
Transcript: ENSMUST00000209690
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ODF3 is a component of sperm flagella outer dense fibers, which add stiffness, elastic recoil, and protection against shearing forces during sperm movement.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Abca8a T C 11: 110,042,105 D1231G probably damaging Het
Adcy7 A G 8: 88,327,393 I1017V probably benign Het
Agpat2 A G 2: 26,597,239 I109T probably damaging Het
Aldh9a1 G A 1: 167,352,628 R97H probably damaging Het
Als2 G A 1: 59,206,538 T593M probably damaging Het
Ap3d1 G C 10: 80,741,908 H28Q possibly damaging Het
Atxn1 A T 13: 45,566,699 D573E probably damaging Het
BC100530 T A 16: 36,367,452 Q17L probably damaging Het
Begain T A 12: 109,033,118 M576L probably benign Het
Bod1l T C 5: 41,838,076 N109S probably damaging Het
Boll A G 1: 55,346,373 M131T possibly damaging Het
Celf2 T C 2: 6,604,125 R282G probably damaging Het
Cers2 T C 3: 95,322,459 F330L probably benign Het
Chst13 T C 6: 90,309,158 D274G probably benign Het
Dclk2 A G 3: 86,793,223 V649A probably damaging Het
Deaf1 T C 7: 141,314,454 *54W probably null Het
Fbf1 C T 11: 116,157,688 probably null Het
Fbxo32 C T 15: 58,207,972 S71N probably benign Het
Fbxo42 T A 4: 141,200,510 N700K probably damaging Het
Fis1 T C 5: 136,963,117 I55T possibly damaging Het
Fyco1 A T 9: 123,834,826 L121* probably null Het
Gm2381 G A 7: 42,820,407 P98S probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Gtf2ird1 G A 5: 134,359,007 T946I probably damaging Het
Hmcn1 G T 1: 150,563,599 Y5494* probably null Het
Josd2 A G 7: 44,468,973 probably null Het
Lfng T A 5: 140,611,867 D149E probably damaging Het
Lrp1 C T 10: 127,542,296 A4052T probably damaging Het
Lrrtm3 T C 10: 64,089,031 N119S probably damaging Het
Lypd6 C T 2: 50,165,652 P38L probably damaging Het
Msl3l2 T C 10: 56,115,442 C88R probably benign Het
Nsd1 A G 13: 55,213,692 T158A probably damaging Het
Nudt22 A T 19: 6,993,484 S239R probably benign Het
Olfr1288 T C 2: 111,479,354 M190T probably benign Het
Olfr584 A T 7: 103,086,112 D193V probably damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Otop3 T C 11: 115,344,558 F339L probably damaging Het
Pcdhga10 T A 18: 37,748,200 V338E possibly damaging Het
Pcnx2 A G 8: 125,760,927 F1779S probably damaging Het
Plxna4 T C 6: 32,185,532 K1349E probably damaging Het
Poteg A T 8: 27,481,676 N406I probably benign Het
Ppp4r4 T C 12: 103,606,933 V697A probably benign Het
Ptpra C A 2: 130,544,999 H603Q probably benign Het
Rnf10 T C 5: 115,249,112 D439G probably benign Het
Rnf43 T A 11: 87,732,267 N731K probably benign Het
Slc2a4 T A 11: 69,946,171 N116Y probably damaging Het
Slc6a15 C A 10: 103,404,691 H392N probably benign Het
Slco6d1 C T 1: 98,466,716 T375I probably benign Het
Smpd4 A G 16: 17,642,212 D436G probably damaging Het
Spata22 G A 11: 73,353,745 W311* probably null Het
Syt3 G A 7: 44,393,442 V383I probably benign Het
Tle6 T A 10: 81,594,401 I306F probably damaging Het
Tox3 G A 8: 90,248,390 Q538* probably null Het
Trim24 T A 6: 37,956,453 S656T probably damaging Het
Trnau1ap C A 4: 132,321,734 V119F possibly damaging Het
Vmn1r181 G T 7: 23,984,518 S136I possibly damaging Het
Vmn1r82 T C 7: 12,305,406 V202A probably damaging Het
Zfp607b G A 7: 27,702,394 V92I probably benign Het
Zfp964 G C 8: 69,663,854 C368S unknown Het
Zw10 A G 9: 49,057,641 probably null Het
Other mutations in Odf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0051:Odf3 UTSW 7 140850221 unclassified probably benign
R0547:Odf3 UTSW 7 140848815 splice site probably null
R0981:Odf3 UTSW 7 140848295 missense probably benign 0.00
R1221:Odf3 UTSW 7 140848383 missense probably damaging 1.00
R4833:Odf3 UTSW 7 140848278 start codon destroyed probably null
R4854:Odf3 UTSW 7 140849462 missense probably damaging 1.00
R4896:Odf3 UTSW 7 140848485 intron probably benign
R5109:Odf3 UTSW 7 140849548 missense probably benign 0.11
R6110:Odf3 UTSW 7 140848641 missense possibly damaging 0.73
R6354:Odf3 UTSW 7 140850614 unclassified probably null
R6441:Odf3 UTSW 7 140849248 missense probably damaging 1.00
R6516:Odf3 UTSW 7 140848805 missense probably damaging 0.99
R6672:Odf3 UTSW 7 140848427 missense probably benign 0.27
R7086:Odf3 UTSW 7 140849489 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATGTTGGGGTCTAGAAGCC -3'
(R):5'- CACCACAGGCAGCATGTATG -3'

Sequencing Primer
(F):5'- TGTCTTAATTGTTGGGACACCC -3'
(R):5'- ATGTATGCAGCAGGGCCTG -3'
Posted On2014-12-04