Incidental Mutation 'R2510:Scn5a'
ID251982
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
MMRRC Submission 040416-MU
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119533685 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 623 (V623E)
Ref Sequence ENSEMBL: ENSMUSP00000113272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420]
Predicted Effect probably benign
Transcript: ENSMUST00000065196
AA Change: V623E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: V623E

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117911
AA Change: V623E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: V623E

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120420
AA Change: V623E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: V623E

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Meta Mutation Damage Score 0.1372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pcnx4 T C 12: 72,566,972 W564R probably damaging Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
PIT4520001:Scn5a UTSW 9 119534570 missense possibly damaging 0.56
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1530:Scn5a UTSW 9 119495562 missense probably damaging 1.00
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R4867:Scn5a UTSW 9 119550671 nonsense probably null
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5560:Scn5a UTSW 9 119560286 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6046:Scn5a UTSW 9 119562374 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7145:Scn5a UTSW 9 119486371 missense probably damaging 1.00
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTTGGCATGGAAACTATAAG -3'
(R):5'- AGGCTCCGAGGCAGATTTTG -3'

Sequencing Primer
(F):5'- CTATAAGGGGAGAGATGTTCTGG -3'
(R):5'- TTTTGCAGATGACGAGAACAGTAC -3'
Posted On2014-12-04