Incidental Mutation 'R2510:Pcnx4'
ID252016
Institutional Source Beutler Lab
Gene Symbol Pcnx4
Ensembl Gene ENSMUSG00000034501
Gene Namepecanex homolog 4
Synonyms1810048J11Rik, Pcnxl4
MMRRC Submission 040416-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R2510 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72536383-72580119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72566972 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 564 (W564R)
Ref Sequence ENSEMBL: ENSMUSP00000038916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044352]
Predicted Effect probably damaging
Transcript: ENSMUST00000044352
AA Change: W564R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038916
Gene: ENSMUSG00000034501
AA Change: W564R

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
transmembrane domain 247 264 N/A INTRINSIC
transmembrane domain 296 330 N/A INTRINSIC
transmembrane domain 368 390 N/A INTRINSIC
transmembrane domain 400 417 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
transmembrane domain 546 564 N/A INTRINSIC
transmembrane domain 577 599 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Pfam:Pecanex_C 999 1174 4.2e-28 PFAM
Meta Mutation Damage Score 0.392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
4930571K23Rik C A 7: 125,369,139 noncoding transcript Het
Adra1d C A 2: 131,562,135 E12* probably null Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Atxn2 C T 5: 121,781,393 S388L probably damaging Het
Bbox1 A T 2: 110,305,631 M1K probably null Het
Btaf1 G A 19: 37,002,445 R1538H probably benign Het
Car11 G A 7: 45,701,359 G93E probably damaging Het
Col18a1 A G 10: 77,096,268 L329P unknown Het
Copb2 T A 9: 98,571,648 probably benign Het
Dnah2 G T 11: 69,524,206 S234* probably null Het
Dnah9 T C 11: 66,005,169 Y2460C probably damaging Het
Dnaic2 G C 11: 114,757,167 probably benign Het
Dst C A 1: 34,212,286 T1814K probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fancm A T 12: 65,113,770 probably benign Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
G530012D18Rik T G 1: 85,577,204 probably benign Het
Gca T G 2: 62,689,974 S159R probably damaging Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm10639 T A 9: 78,294,807 M1K probably null Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5117 T A 8: 31,738,355 noncoding transcript Het
Gm5900 T A 7: 104,950,364 noncoding transcript Het
Gpi1 A G 7: 34,205,923 S359P probably damaging Het
Grm5 A G 7: 88,036,091 E472G probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Ift140 T C 17: 25,036,308 I466T probably benign Het
Kansl2 A G 15: 98,528,861 probably null Het
Kat2a T C 11: 100,712,142 Q88R probably benign Het
Kcnh7 T C 2: 62,721,917 D910G probably benign Het
Klk1b1 T C 7: 43,969,379 V60A probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Llgl1 A G 11: 60,710,036 K653E probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Mafb T G 2: 160,366,576 E34A probably damaging Het
Meiob T C 17: 24,816,597 probably benign Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mprip T A 11: 59,749,508 probably benign Het
Muc5b A T 7: 141,859,061 N1915Y unknown Het
Mycbp2 C T 14: 103,155,255 R3290Q probably damaging Het
Obscn G A 11: 59,042,314 probably benign Het
Olfm3 T A 3: 115,122,310 V277D probably damaging Het
Olfr1271 C T 2: 90,265,606 V275I probably damaging Het
Olfr1286 G A 2: 111,420,451 P167S possibly damaging Het
Olfr668 G A 7: 104,925,687 H26Y probably benign Het
Olfr960 T A 9: 39,623,431 F101I probably damaging Het
Omp A T 7: 98,145,345 M25K possibly damaging Het
Otoa C T 7: 121,160,472 T1099I probably benign Het
Pcdh15 T G 10: 74,631,499 S1715A probably benign Het
Pde12 T C 14: 26,665,526 *609W probably null Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Ppp1r37 T C 7: 19,532,432 K470E possibly damaging Het
Ptprd C A 4: 76,086,011 probably null Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rims2 T G 15: 39,585,652 S1217R probably damaging Het
Rorc C T 3: 94,389,120 T208I probably benign Het
Ryr3 C T 2: 112,675,904 E3458K probably benign Het
Scn5a A T 9: 119,533,685 V623E probably benign Het
Slc28a2 C T 2: 122,451,016 Q229* probably null Het
Slc35f3 C T 8: 126,298,706 probably benign Het
Spg11 T G 2: 122,075,310 I1285L probably benign Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Susd1 A T 4: 59,349,855 V527E possibly damaging Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Ttn T C 2: 76,740,992 D26519G probably damaging Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn1r37 T C 6: 66,731,951 L150P probably damaging Het
Vmn2r52 G T 7: 10,170,868 A348E probably benign Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Wdyhv1 C A 15: 58,153,624 A145D probably damaging Het
Ypel5 T C 17: 72,846,391 L30P probably damaging Het
Zfp985 A G 4: 147,582,986 T104A possibly damaging Het
Other mutations in Pcnx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Pcnx4 APN 12 72579365 missense probably damaging 0.97
IGL01160:Pcnx4 APN 12 72579377 missense probably damaging 1.00
IGL01385:Pcnx4 APN 12 72573746 missense probably damaging 1.00
IGL01452:Pcnx4 APN 12 72574400 missense possibly damaging 0.79
IGL01984:Pcnx4 APN 12 72574409 missense probably benign 0.25
IGL02073:Pcnx4 APN 12 72574328 missense possibly damaging 0.92
IGL02726:Pcnx4 APN 12 72574212 missense probably benign 0.12
IGL02824:Pcnx4 APN 12 72555571 missense probably benign 0.02
R0007:Pcnx4 UTSW 12 72555579 missense possibly damaging 0.79
R0158:Pcnx4 UTSW 12 72556302 missense probably benign
R0575:Pcnx4 UTSW 12 72567236 missense probably benign 0.00
R0783:Pcnx4 UTSW 12 72575478 missense probably damaging 1.00
R1420:Pcnx4 UTSW 12 72555986 missense probably benign
R1497:Pcnx4 UTSW 12 72574400 missense probably benign 0.03
R2093:Pcnx4 UTSW 12 72579442 missense probably damaging 1.00
R2241:Pcnx4 UTSW 12 72574154 missense probably damaging 0.99
R2287:Pcnx4 UTSW 12 72575398 missense probably benign 0.05
R2418:Pcnx4 UTSW 12 72556263 missense probably damaging 1.00
R2437:Pcnx4 UTSW 12 72541813 missense probably damaging 1.00
R2509:Pcnx4 UTSW 12 72566972 missense probably damaging 1.00
R2512:Pcnx4 UTSW 12 72556799 critical splice acceptor site probably null
R3691:Pcnx4 UTSW 12 72573719 missense probably damaging 1.00
R3760:Pcnx4 UTSW 12 72567006 missense probably damaging 1.00
R3949:Pcnx4 UTSW 12 72556302 missense probably benign
R4065:Pcnx4 UTSW 12 72556360 critical splice donor site probably null
R4757:Pcnx4 UTSW 12 72556293 missense probably benign 0.00
R4804:Pcnx4 UTSW 12 72574202 missense probably benign 0.28
R4867:Pcnx4 UTSW 12 72573952 missense probably benign 0.01
R4879:Pcnx4 UTSW 12 72567185 missense probably damaging 1.00
R5108:Pcnx4 UTSW 12 72574081 missense probably benign 0.01
R5350:Pcnx4 UTSW 12 72579364 missense probably damaging 1.00
R5504:Pcnx4 UTSW 12 72574448 missense probably damaging 1.00
R5718:Pcnx4 UTSW 12 72567194 missense possibly damaging 0.49
R5943:Pcnx4 UTSW 12 72579458 missense probably damaging 0.99
R6195:Pcnx4 UTSW 12 72556874 missense possibly damaging 0.92
R7134:Pcnx4 UTSW 12 72566976 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGTCCCCTCAAAATACTGAG -3'
(R):5'- TGGTGGTAGAACACACTGTC -3'

Sequencing Primer
(F):5'- TCTGTATCCACAGATCGG -3'
(R):5'- ACTGTCGGTGCACACAC -3'
Posted On2014-12-04