Incidental Mutation 'R2850:Clk1'
ID252034
Institutional Source Beutler Lab
Gene Symbol Clk1
Ensembl Gene ENSMUSG00000026034
Gene NameCDC-like kinase 1
SynonymsClk1, STY
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2850 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58410189-58424066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58412279 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 457 (L457S)
Ref Sequence ENSEMBL: ENSMUSP00000034868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034868] [ENSMUST00000050552] [ENSMUST00000148330] [ENSMUST00000151338]
Predicted Effect probably damaging
Transcript: ENSMUST00000034868
AA Change: L457S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034868
Gene: ENSMUSG00000026034
AA Change: L457S

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 139 N/A INTRINSIC
S_TKc 160 476 3.55e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050552
SMART Domains Protein: ENSMUSP00000051935
Gene: ENSMUSG00000051223

DomainStartEndE-ValueType
eIF5C 325 410 3.75e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141570
Predicted Effect probably benign
Transcript: ENSMUST00000148330
SMART Domains Protein: ENSMUSP00000137649
Gene: ENSMUSG00000026034

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151338
SMART Domains Protein: ENSMUSP00000137815
Gene: ENSMUSG00000026034

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186552
Meta Mutation Damage Score 0.53 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CDC2-like (or LAMMER) family of dual specificity protein kinases. In the nucleus, the encoded protein phosphorylates serine/arginine-rich proteins involved in pre-mRNA processing, releasing them into the nucleoplasm. The choice of splice sites during pre-mRNA processing may be regulated by the concentration of transacting factors, including serine/arginine rich proteins. Therefore, the encoded protein may play an indirect role in governing splice site selection. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ago1 T C 4: 126,443,075 probably benign Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Ctr9 C T 7: 111,053,446 R984C unknown Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Olfr1454 T C 19: 13,063,570 L53P probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Stard6 T A 18: 70,483,451 H60Q probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Clk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Clk1 APN 1 58413452 missense possibly damaging 0.93
IGL01516:Clk1 APN 1 58414404 missense probably damaging 1.00
IGL01684:Clk1 APN 1 58417265 critical splice donor site probably null
IGL02621:Clk1 APN 1 58414455 missense probably damaging 1.00
IGL02812:Clk1 APN 1 58414476 missense probably damaging 0.98
IGL03028:Clk1 APN 1 58421102 nonsense probably null
IGL03117:Clk1 APN 1 58417007 splice site probably null
PIT4243001:Clk1 UTSW 1 58419677 missense probably damaging 1.00
R0149:Clk1 UTSW 1 58414601 missense probably damaging 1.00
R0309:Clk1 UTSW 1 58413033 splice site probably benign
R0730:Clk1 UTSW 1 58414399 missense probably benign 0.38
R1570:Clk1 UTSW 1 58414425 missense probably benign 0.28
R1729:Clk1 UTSW 1 58421261 missense probably damaging 1.00
R1905:Clk1 UTSW 1 58421942 splice site probably benign
R2382:Clk1 UTSW 1 58421289 missense probably benign 0.01
R4658:Clk1 UTSW 1 58412987 missense probably benign 0.01
R4846:Clk1 UTSW 1 58421102 missense probably benign 0.33
R5011:Clk1 UTSW 1 58414483 missense probably benign
R5196:Clk1 UTSW 1 58414613 missense probably benign 0.00
R5699:Clk1 UTSW 1 58420195 missense probably damaging 1.00
R5838:Clk1 UTSW 1 58412660 missense probably damaging 1.00
R5839:Clk1 UTSW 1 58421915 missense probably benign 0.09
R6697:Clk1 UTSW 1 58414622 missense probably benign 0.21
R7293:Clk1 UTSW 1 58414613 missense probably benign 0.00
R7332:Clk1 UTSW 1 58412694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TACTGTAGAAAGACCGTACACCAAG -3'
(R):5'- TCCAAAAGAGAGGCCTGGTAAC -3'

Sequencing Primer
(F):5'- GGTTTGGCCATGTATTTAATAAAGC -3'
(R):5'- CCTGGCATCCCATGATTGTAAATGG -3'
Posted On2014-12-04