Mutagenetix > Incidental Mutation

Incidental Mutation 'R2850:Cubn'

252039

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin

Synonyms

D2Wsu88e, intrinsic factor-cobalamin receptor

MMRRC Submission

040443-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2850 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13281149-13496624 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13327764 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2687 (T2687I)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: T2687I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: T2687I

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149137

Meta Mutation Damage Score

0.1680

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actn2	T	A	13: 12,290,065 (GRCm39)	T734S	probably damaging	Het
Ago1	T	C	4: 126,336,868 (GRCm39)		probably benign	Het
Ahi1	C	T	10: 20,876,492 (GRCm39)	T801I	probably benign	Het
Alms1	T	C	6: 85,598,281 (GRCm39)	S1505P	probably benign	Het
Alms1	C	A	6: 85,644,945 (GRCm39)		probably benign	Het
Anxa6	T	A	11: 54,901,852 (GRCm39)	Y95F	possibly damaging	Het
Cacna1b	C	T	2: 24,651,800 (GRCm39)	M126I	probably damaging	Het
Clk1	A	G	1: 58,451,438 (GRCm39)	L457S	probably damaging	Het
Cngb3	T	C	4: 19,415,690 (GRCm39)	I400T	possibly damaging	Het
Cntnap5c	T	A	17: 58,717,343 (GRCm39)		probably benign	Het
Corin	A	G	5: 72,462,298 (GRCm39)	V837A	probably damaging	Het
Ctr9	C	T	7: 110,652,653 (GRCm39)	R984C	unknown	Het
Cypt3	T	A	X: 152,342,274 (GRCm39)	N168K	probably damaging	Het
E330020D12Rik	A	G	1: 153,282,336 (GRCm39)		noncoding transcript	Het
Fbxl4	T	C	4: 22,403,624 (GRCm39)	M399T	probably benign	Het
Fbxo22	T	C	9: 55,130,699 (GRCm39)	F323L	probably damaging	Het
Fnip1	A	T	11: 54,393,503 (GRCm39)	E646D	probably benign	Het
Gid4	G	A	11: 60,329,400 (GRCm39)		probably null	Het
Gnb5	A	T	9: 75,234,511 (GRCm39)	D70V	probably damaging	Het
Gpank1	A	G	17: 35,343,557 (GRCm39)	S346G	probably benign	Het
Gtf3c6	T	C	10: 40,130,254 (GRCm39)		probably benign	Het
Hdx	T	C	X: 110,502,720 (GRCm39)	I562V	probably benign	Het
Ifrd2	T	C	9: 107,468,908 (GRCm39)		probably benign	Het
Itch	A	C	2: 155,044,141 (GRCm39)	Q482P	probably benign	Het
Kif11	C	A	19: 37,397,941 (GRCm39)	D630E	probably benign	Het
Lpl	G	T	8: 69,352,164 (GRCm39)	E372*	probably null	Het
Mrps26	T	C	2: 130,406,967 (GRCm39)	V198A	probably benign	Het
Mucl1	T	C	15: 103,782,348 (GRCm39)	N201S	possibly damaging	Het
Nedd4	C	T	9: 72,632,356 (GRCm39)	L397F	possibly damaging	Het
Nfat5	A	G	8: 108,020,492 (GRCm39)	D12G	probably damaging	Het
Or5b102	T	C	19: 13,040,934 (GRCm39)	L53P	probably damaging	Het
Pik3r3	A	G	4: 116,127,981 (GRCm39)		probably benign	Het
Pkd1l3	T	A	8: 110,350,622 (GRCm39)	V489E	possibly damaging	Het
Pkhd1	T	C	1: 20,579,300 (GRCm39)	E1802G	possibly damaging	Het
Plb1	T	A	5: 32,450,568 (GRCm39)	S370T	probably benign	Het
Ppat	G	A	5: 77,067,222 (GRCm39)	T337I	probably benign	Het
Prkd3	A	G	17: 79,262,025 (GRCm39)	V763A	possibly damaging	Het
Prr9	A	T	3: 92,030,476 (GRCm39)	S55T	probably benign	Het
Rbpms	G	T	8: 34,324,405 (GRCm39)	N108K	possibly damaging	Het
Rc3h2	A	T	2: 37,267,427 (GRCm39)	D972E	probably benign	Het
Rrbp1	C	T	2: 143,791,269 (GRCm39)	R1378Q	probably benign	Het
Slc26a7	T	A	4: 14,593,806 (GRCm39)		probably benign	Het
Stard6	T	A	18: 70,616,522 (GRCm39)	H60Q	probably benign	Het
Sult6b2	T	C	6: 142,743,613 (GRCm39)	T138A	probably benign	Het
Th	G	A	7: 142,447,812 (GRCm39)	Q329*	probably null	Het
Tmco3	A	G	8: 13,345,024 (GRCm39)	H268R	probably benign	Het
Tnn	T	C	1: 159,966,857 (GRCm39)	D429G	probably benign	Het
Tnrc6a	G	A	7: 122,779,023 (GRCm39)	G1245R	probably damaging	Het
Trem3	C	A	17: 48,556,669 (GRCm39)	L47M	probably benign	Het
Trpm6	T	A	19: 18,769,454 (GRCm39)	C307S	possibly damaging	Het
Ube2j1	T	A	4: 33,049,696 (GRCm39)	N231K	probably benign	Het
Urb1	A	G	16: 90,571,144 (GRCm39)	Y1222H	probably benign	Het
Wdr81	A	T	11: 75,341,998 (GRCm39)	S1090T	probably damaging	Het
Ythdf3	T	C	3: 16,257,982 (GRCm39)		probably benign	Het
Zfp280d	A	G	9: 72,219,371 (GRCm39)	T183A	probably benign	Het
Zfp354c	G	A	11: 50,706,158 (GRCm39)	Q306*	probably null	Het
Zp2	T	C	7: 119,737,529 (GRCm39)	H252R	probably benign	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13,496,631 (GRCm39)	unclassified	probably benign
IGL00228:Cubn	APN	2	13,461,508 (GRCm39)	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13,386,660 (GRCm39)	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13,431,867 (GRCm39)	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13,283,229 (GRCm39)	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13,287,730 (GRCm39)	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13,299,041 (GRCm39)	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13,472,521 (GRCm39)	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13,386,738 (GRCm39)	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13,461,434 (GRCm39)	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13,283,219 (GRCm39)	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13,482,904 (GRCm39)	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13,315,377 (GRCm39)	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13,470,719 (GRCm39)	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13,288,852 (GRCm39)	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13,355,673 (GRCm39)	splice site	probably benign
IGL01534:Cubn	APN	2	13,470,744 (GRCm39)	nonsense	probably null
IGL01584:Cubn	APN	2	13,313,472 (GRCm39)	splice site	probably benign
IGL01595:Cubn	APN	2	13,330,027 (GRCm39)	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13,311,085 (GRCm39)	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13,494,747 (GRCm39)	nonsense	probably null
IGL01972:Cubn	APN	2	13,450,883 (GRCm39)	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13,292,405 (GRCm39)	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13,344,657 (GRCm39)	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13,386,648 (GRCm39)	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13,432,645 (GRCm39)	splice site	probably null
IGL02491:Cubn	APN	2	13,326,039 (GRCm39)	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13,330,037 (GRCm39)	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13,450,843 (GRCm39)	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13,449,851 (GRCm39)	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13,299,181 (GRCm39)	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13,323,123 (GRCm39)	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13,291,905 (GRCm39)	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13,360,500 (GRCm39)	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13,431,778 (GRCm39)	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13,365,140 (GRCm39)	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13,482,868 (GRCm39)	splice site	probably null
mellow	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13,473,663 (GRCm39)	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13,496,561 (GRCm39)	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13,311,243 (GRCm39)	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13,361,520 (GRCm39)	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13,480,846 (GRCm39)	critical splice donor site	probably null
R0254:Cubn	UTSW	2	13,445,325 (GRCm39)	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13,429,505 (GRCm39)	missense	probably benign	0.01
R0360:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0364:Cubn	UTSW	2	13,315,318 (GRCm39)	splice site	probably benign
R0383:Cubn	UTSW	2	13,435,770 (GRCm39)	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13,474,575 (GRCm39)	missense	possibly damaging	0.87
R0419:Cubn	UTSW	2	13,474,574 (GRCm39)	missense	possibly damaging	0.77
R0498:Cubn	UTSW	2	13,449,078 (GRCm39)	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13,433,491 (GRCm39)	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13,365,063 (GRCm39)	splice site	probably null
R0735:Cubn	UTSW	2	13,496,500 (GRCm39)	splice site	probably benign
R0780:Cubn	UTSW	2	13,461,424 (GRCm39)	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13,367,139 (GRCm39)	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13,341,053 (GRCm39)	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13,449,811 (GRCm39)	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13,365,130 (GRCm39)	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13,330,099 (GRCm39)	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13,480,931 (GRCm39)	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13,431,916 (GRCm39)	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13,292,472 (GRCm39)	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13,432,778 (GRCm39)	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13,474,600 (GRCm39)	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13,494,128 (GRCm39)	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13,313,372 (GRCm39)	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13,327,813 (GRCm39)	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13,315,337 (GRCm39)	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13,283,349 (GRCm39)	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13,344,828 (GRCm39)	splice site	probably null
R2021:Cubn	UTSW	2	13,313,360 (GRCm39)	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13,449,189 (GRCm39)	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13,340,978 (GRCm39)	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13,323,053 (GRCm39)	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13,408,891 (GRCm39)	nonsense	probably null
R2369:Cubn	UTSW	2	13,496,028 (GRCm39)	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13,480,961 (GRCm39)	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13,323,083 (GRCm39)	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13,283,167 (GRCm39)	splice site	probably null
R2853:Cubn	UTSW	2	13,435,645 (GRCm39)	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13,362,950 (GRCm39)	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13,367,158 (GRCm39)	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13,362,973 (GRCm39)	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13,338,319 (GRCm39)	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13,355,754 (GRCm39)	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13,336,396 (GRCm39)	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13,432,725 (GRCm39)	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13,365,164 (GRCm39)	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13,299,136 (GRCm39)	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13,287,819 (GRCm39)	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13,291,791 (GRCm39)	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13,331,488 (GRCm39)	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13,318,810 (GRCm39)	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13,433,374 (GRCm39)	intron	probably benign
R4405:Cubn	UTSW	2	13,470,841 (GRCm39)	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13,433,560 (GRCm39)	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13,318,790 (GRCm39)	splice site	probably null
R4770:Cubn	UTSW	2	13,319,578 (GRCm39)	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13,291,835 (GRCm39)	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13,355,869 (GRCm39)	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13,463,887 (GRCm39)	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13,330,036 (GRCm39)	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13,494,721 (GRCm39)	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13,352,856 (GRCm39)	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13,292,379 (GRCm39)	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13,483,013 (GRCm39)	nonsense	probably null
R5305:Cubn	UTSW	2	13,393,750 (GRCm39)	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13,496,506 (GRCm39)	splice site	probably null
R5530:Cubn	UTSW	2	13,313,334 (GRCm39)	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13,355,743 (GRCm39)	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13,393,702 (GRCm39)	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13,324,834 (GRCm39)	splice site	probably benign
R5923:Cubn	UTSW	2	13,490,889 (GRCm39)	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13,329,995 (GRCm39)	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13,435,708 (GRCm39)	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13,313,429 (GRCm39)	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13,354,687 (GRCm39)	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13,482,889 (GRCm39)	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13,285,006 (GRCm39)	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13,480,934 (GRCm39)	missense	probably damaging	0.98
R6368:Cubn	UTSW	2	13,435,806 (GRCm39)	missense	probably damaging	0.96
R6383:Cubn	UTSW	2	13,432,646 (GRCm39)	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13,360,491 (GRCm39)	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13,299,014 (GRCm39)	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13,463,813 (GRCm39)	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13,315,484 (GRCm39)	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13,435,683 (GRCm39)	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13,480,875 (GRCm39)	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13,326,066 (GRCm39)	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13,449,840 (GRCm39)	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13,449,064 (GRCm39)	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13,323,089 (GRCm39)	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13,352,840 (GRCm39)	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13,386,648 (GRCm39)	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13,491,600 (GRCm39)	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13,311,092 (GRCm39)	missense	probably benign	0.10
R7076:Cubn	UTSW	2	13,311,091 (GRCm39)	missense	probably benign	0.00
R7086:Cubn	UTSW	2	13,324,669 (GRCm39)	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13,347,309 (GRCm39)	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13,355,814 (GRCm39)	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13,429,550 (GRCm39)	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13,345,143 (GRCm39)	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13,473,582 (GRCm39)	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13,291,875 (GRCm39)	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13,431,778 (GRCm39)	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13,327,804 (GRCm39)	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13,460,320 (GRCm39)	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7699:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7700:Cubn	UTSW	2	13,494,728 (GRCm39)	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13,352,989 (GRCm39)	missense	probably benign
R7751:Cubn	UTSW	2	13,365,176 (GRCm39)	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13,284,889 (GRCm39)	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13,352,961 (GRCm39)	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13,473,680 (GRCm39)	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13,429,538 (GRCm39)	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13,337,166 (GRCm39)	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13,340,897 (GRCm39)	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13,483,989 (GRCm39)	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13,336,471 (GRCm39)	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13,393,659 (GRCm39)	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13,299,129 (GRCm39)	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13,354,688 (GRCm39)	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13,491,613 (GRCm39)	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13,311,274 (GRCm39)	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13,345,053 (GRCm39)	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13,435,658 (GRCm39)	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13,433,535 (GRCm39)	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13,329,971 (GRCm39)	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13,433,567 (GRCm39)	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13,386,610 (GRCm39)	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13,432,658 (GRCm39)	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13,318,855 (GRCm39)	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13,313,331 (GRCm39)	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13,388,770 (GRCm39)	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13,313,377 (GRCm39)	nonsense	probably null
R8874:Cubn	UTSW	2	13,365,157 (GRCm39)	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13,461,466 (GRCm39)	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13,291,914 (GRCm39)	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13,337,276 (GRCm39)	splice site	probably benign
R9261:Cubn	UTSW	2	13,283,262 (GRCm39)	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13,386,703 (GRCm39)	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13,463,767 (GRCm39)	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13,292,510 (GRCm39)	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13,482,945 (GRCm39)	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13,325,991 (GRCm39)	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13,319,529 (GRCm39)	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13,433,530 (GRCm39)	missense	probably benign
X0018:Cubn	UTSW	2	13,463,797 (GRCm39)	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13,480,887 (GRCm39)	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13,347,392 (GRCm39)	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13,327,773 (GRCm39)	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13,388,803 (GRCm39)	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13,299,040 (GRCm39)	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13,386,636 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCATAAGAATATAGTGGGGTCTC -3'
(R):5'- AATGCCTGCTACTGTACCAGG -3'

Sequencing Primer
(F):5'- gggtctccagaataaaggaaa -3'
(R):5'- GTAACCATGTCACTTGCTATACTG -3'

Posted On

2014-12-04