Incidental Mutation 'R0311:Olfr912'
ID25207
Institutional Source Beutler Lab
Gene Symbol Olfr912
Ensembl Gene ENSMUSG00000111448
Gene Nameolfactory receptor 912
SynonymsMOR165-4, GA_x6K02T2PVTD-32283590-32284522
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38580178-38586876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38539297 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 134 (V134A)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect probably benign
Transcript: ENSMUST00000073214
AA Change: V134A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: V134A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215122
AA Change: V134A

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Olfr912
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr912 APN 9 38581376 missense probably damaging 0.97
IGL01099:Olfr912 APN 9 38582077 missense probably benign 0.00
IGL01749:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01750:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01751:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01752:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01753:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02262:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02264:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02298:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02305:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581433 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02317:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02401:Olfr912 APN 9 38581355 missense probably damaging 1.00
R0973:Olfr912 UTSW 9 38581283 missense possibly damaging 0.74
R1552:Olfr912 UTSW 9 38581379 missense probably benign 0.00
R1720:Olfr912 UTSW 9 38581289 missense probably benign
R2149:Olfr912 UTSW 9 38581508 missense probably benign 0.02
R2241:Olfr912 UTSW 9 38581805 missense probably damaging 1.00
R3622:Olfr912 UTSW 9 38581496 missense probably damaging 1.00
R4384:Olfr912 UTSW 9 38582053 missense probably damaging 1.00
R4686:Olfr912 UTSW 9 38582031 missense probably damaging 1.00
R4780:Olfr912 UTSW 9 38581969 missense possibly damaging 0.84
R5221:Olfr912 UTSW 9 38581852 missense probably damaging 1.00
R5503:Olfr912 UTSW 9 38582072 missense probably benign
R5887:Olfr912 UTSW 9 38581784 missense probably damaging 1.00
R6062:Olfr912 UTSW 9 38539144 missense probably damaging 0.97
R6516:Olfr912 UTSW 9 38581472 missense probably damaging 1.00
R6542:Olfr912 UTSW 9 38539437 missense probably benign 0.01
R6766:Olfr912 UTSW 9 38581773 missense probably damaging 1.00
R7057:Olfr912 UTSW 9 38581754 missense probably damaging 1.00
R7112:Olfr912 UTSW 9 38582034 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTATCAGGCATTCCCACCACAGG -3'
(R):5'- AGCTGCATCAAAGGCAGAAGATCAC -3'

Sequencing Primer
(F):5'- AACTGCCTTTGGGAATTTGACC -3'
(R):5'- CACAGAAGTAGTGATTGATGGTGTTC -3'
Posted On2013-04-16