Incidental Mutation 'R2850:Ctr9'
ID252079
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission 040443-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2850 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111053446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 984 (R984C)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect unknown
Transcript: ENSMUST00000005749
AA Change: R984C
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: R984C

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209912
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn2 T A 13: 12,275,179 T734S probably damaging Het
Ago1 T C 4: 126,443,075 probably benign Het
Ahi1 C T 10: 21,000,593 T801I probably benign Het
Alms1 T C 6: 85,621,299 S1505P probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Anxa6 T A 11: 55,011,026 Y95F possibly damaging Het
Cacna1b C T 2: 24,761,788 M126I probably damaging Het
Clk1 A G 1: 58,412,279 L457S probably damaging Het
Cngb3 T C 4: 19,415,690 I400T possibly damaging Het
Cntnap5c T A 17: 58,410,348 probably benign Het
Corin A G 5: 72,304,955 V837A probably damaging Het
Cubn G A 2: 13,322,953 T2687I probably damaging Het
Cypt3 T A X: 153,559,278 N168K probably damaging Het
E330020D12Rik A G 1: 153,406,590 noncoding transcript Het
Fbxl4 T C 4: 22,403,624 M399T probably benign Het
Fbxo22 T C 9: 55,223,415 F323L probably damaging Het
Fnip1 A T 11: 54,502,677 E646D probably benign Het
Gid4 G A 11: 60,438,574 probably null Het
Gnb5 A T 9: 75,327,229 D70V probably damaging Het
Gpank1 A G 17: 35,124,581 S346G probably benign Het
Gtf3c6 T C 10: 40,254,258 probably benign Het
Hdx T C X: 111,593,023 I562V probably benign Het
Ifrd2 T C 9: 107,591,709 probably benign Het
Itch A C 2: 155,202,221 Q482P probably benign Het
Kif11 C A 19: 37,409,493 D630E probably benign Het
Lpl G T 8: 68,899,512 E372* probably null Het
Mrps26 T C 2: 130,565,047 V198A probably benign Het
Mucl1 T C 15: 103,752,082 N201S possibly damaging Het
Nedd4 C T 9: 72,725,074 L397F possibly damaging Het
Nfat5 A G 8: 107,293,860 D12G probably damaging Het
Olfr1454 T C 19: 13,063,570 L53P probably damaging Het
Pik3r3 A G 4: 116,270,784 probably benign Het
Pkd1l3 T A 8: 109,623,990 V489E possibly damaging Het
Pkhd1 T C 1: 20,509,076 E1802G possibly damaging Het
Plb1 T A 5: 32,293,224 S370T probably benign Het
Ppat G A 5: 76,919,375 T337I probably benign Het
Prkd3 A G 17: 78,954,596 V763A possibly damaging Het
Prr9 A T 3: 92,123,169 S55T probably benign Het
Rbpms G T 8: 33,834,377 N108K possibly damaging Het
Rc3h2 A T 2: 37,377,415 D972E probably benign Het
Rrbp1 C T 2: 143,949,349 R1378Q probably benign Het
Slc26a7 T A 4: 14,593,806 probably benign Het
Stard6 T A 18: 70,483,451 H60Q probably benign Het
Sult6b2 T C 6: 142,797,887 T138A probably benign Het
Th G A 7: 142,894,075 Q329* probably null Het
Tmco3 A G 8: 13,295,024 H268R probably benign Het
Tnn T C 1: 160,139,287 D429G probably benign Het
Tnrc6a G A 7: 123,179,800 G1245R probably damaging Het
Trem3 C A 17: 48,249,641 L47M probably benign Het
Trpm6 T A 19: 18,792,090 C307S possibly damaging Het
Ube2j1 T A 4: 33,049,696 N231K probably benign Het
Urb1 A G 16: 90,774,256 Y1222H probably benign Het
Wdr81 A T 11: 75,451,172 S1090T probably damaging Het
Ythdf3 T C 3: 16,203,818 probably benign Het
Zfp280d A G 9: 72,312,089 T183A probably benign Het
Zfp354c G A 11: 50,815,331 Q306* probably null Het
Zp2 T C 7: 120,138,306 H252R probably benign Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2851:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGAGTGCATAGTATAGCTG -3'
(R):5'- ACTGTGGCACTCTGTCAGAC -3'

Sequencing Primer
(F):5'- CTGAGTATCAGTGTCCATACAGAATG -3'
(R):5'- TGTCAGACAGAGACAGACAGAC -3'
Posted On2014-12-04