Incidental Mutation 'R2851:Ctr9'
ID252207
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission 040444-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.974) question?
Stock #R2851 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111053446 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 984 (R984C)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect unknown
Transcript: ENSMUST00000005749
AA Change: R984C
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: R984C

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209912
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Ceacam11 T C 7: 17,978,526 I300T probably benign Het
Cmtm5 A G 14: 54,938,055 probably benign Het
Cnn3 C T 3: 121,450,053 probably benign Het
Col12a1 A T 9: 79,678,332 N1254K probably damaging Het
Crispld2 T A 8: 120,014,089 L107Q probably damaging Het
Cyp1b1 T C 17: 79,710,220 N502S probably benign Het
Cyp51 A T 5: 4,099,183 D231E probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dscam T C 16: 96,622,715 T1677A possibly damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Emilin1 A G 5: 30,917,165 D250G probably benign Het
Frrs1 A G 3: 116,885,129 N200S probably benign Het
Fstl5 T A 3: 76,429,738 probably benign Het
Gmcl1 A C 6: 86,726,177 S92A probably damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Il19 A G 1: 130,935,957 V99A possibly damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Itgad T A 7: 128,204,560 V42E probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mfsd4b2 T A 10: 39,922,123 S79C probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mthfsd G A 8: 121,105,773 T60I probably benign Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Nceh1 A G 3: 27,241,355 Y255C probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ndufb5 T C 3: 32,746,451 F58L probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Obscn C A 11: 59,030,018 probably null Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pias3 A G 3: 96,703,537 E377G possibly damaging Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Ppa2 A T 3: 133,321,003 probably null Het
Proser1 G A 3: 53,480,545 A885T probably benign Het
Robo2 A G 16: 73,961,888 I665T probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Secisbp2 G A 13: 51,654,635 probably null Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Stk11ip A G 1: 75,529,267 probably benign Het
Tbl3 T C 17: 24,702,583 T445A probably damaging Het
Tdrd12 G A 7: 35,485,373 T705M probably damaging Het
Tek A G 4: 94,820,224 T340A probably benign Het
Timm22 G A 11: 76,414,099 A188T probably damaging Het
Tmeff1 T A 4: 48,604,692 probably null Het
Tmprss12 C A 15: 100,282,415 T112K possibly damaging Het
U2surp A G 9: 95,500,682 probably null Het
Vmn2r84 T A 10: 130,394,167 E25D probably benign Het
Wdr62 A T 7: 30,261,437 N22K possibly damaging Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
R6907:Ctr9 UTSW 7 111030242 missense probably damaging 1.00
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCTTGAGTGCATAGTATAG -3'
(R):5'- ACTGTGGCACTCTGTCAGAC -3'

Sequencing Primer
(F):5'- CCCTTGAGTGCATAGTATAGCTGAG -3'
(R):5'- TGTCAGACAGAGACAGACAGAC -3'
Posted On2014-12-04