Incidental Mutation 'R2504:Mast4'
ID252220
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 040412-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #R2504 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102738639 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1215 (I1215N)
Ref Sequence ENSEMBL: ENSMUSP00000131651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000170878] [ENSMUST00000171791] [ENSMUST00000172138]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099202
AA Change: I1230N

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: I1230N

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: I1407N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: I1407N

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: I1215N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: I1215N

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: I1239N
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml5 T C 12: 98,844,105 D864G possibly damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psd A T 19: 46,324,913 M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rps2 G A 17: 24,720,379 probably benign Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Ubr3 T A 2: 69,938,198 F450I probably damaging Het
Usp47 T C 7: 112,104,470 probably null Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTCTAGGCTATGCTTGC -3'
(R):5'- CAATTCTCCAGCAGGTTCAGG -3'

Sequencing Primer
(F):5'- CGGGAGCACAGAAGCTTCTTG -3'
(R):5'- AGCAGGTTCAGGGCACATC -3'
Posted On2014-12-04