Incidental Mutation 'R2504:Rps2'
List |< first << previous [record 86 of 114] next >> last >|
ID252272
Institutional Source Beutler Lab
Gene Symbol Rps2
Ensembl Gene ENSMUSG00000044533
Gene Nameribosomal protein S2
SynonymsLlrep3, Rps2
MMRRC Submission 040412-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R2504 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24718116-24721929 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 24720379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000054289
AA Change: G35D
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533
AA Change: G35D

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect unknown
Transcript: ENSMUST00000146867
AA Change: G35D
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533
AA Change: G35D

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect unknown
Transcript: ENSMUST00000152407
AA Change: G35D
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533
AA Change: G35D

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Predicted Effect unknown
Transcript: ENSMUST00000170715
AA Change: G35D
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533
AA Change: G35D

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml5 T C 12: 98,844,105 D864G possibly damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Mast4 A T 13: 102,738,639 I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psd A T 19: 46,324,913 M6K possibly damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Ubr3 T A 2: 69,938,198 F450I probably damaging Het
Usp47 T C 7: 112,104,470 probably null Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Rps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Rps2 APN 17 24720676 missense probably damaging 1.00
IGL02981:Rps2 APN 17 24721724 missense probably benign 0.00
IGL03123:Rps2 APN 17 24720289 unclassified probably benign
R3160:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3161:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3162:Rps2 UTSW 17 24720978 missense probably benign 0.16
R5877:Rps2 UTSW 17 24720916 intron probably benign
R7247:Rps2 UTSW 17 24720580 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCGGACAGACACAGTTTTGG -3'
(R):5'- TCCAAGGACTTGATCTTCATGTC -3'

Sequencing Primer
(F):5'- ACACAGTTTTGGCAGGACC -3'
(R):5'- GATCTTCATGTCCTTAACCAGACGG -3'
Posted On2014-12-04