Incidental Mutation 'R2504:Psd'
ID252294
Institutional Source Beutler Lab
Gene Symbol Psd
Ensembl Gene ENSMUSG00000037126
Gene Namepleckstrin and Sec7 domain containing
SynonymsPsdl, Efa6a, Efa6, 1110007H17Rik
MMRRC Submission 040412-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2504 (G1)
Quality Score155
Status Not validated
Chromosome19
Chromosomal Location46312087-46327156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46324913 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 6 (M6K)
Ref Sequence ENSEMBL: ENSMUSP00000152942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026256] [ENSMUST00000041391] [ENSMUST00000051234] [ENSMUST00000096029] [ENSMUST00000167861] [ENSMUST00000177667] [ENSMUST00000223903] [ENSMUST00000223917] [ENSMUST00000224447] [ENSMUST00000225323] [ENSMUST00000225781]
Predicted Effect probably benign
Transcript: ENSMUST00000026256
SMART Domains Protein: ENSMUSP00000026256
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 1.9e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000041391
AA Change: M6K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126
AA Change: M6K

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000051234
SMART Domains Protein: ENSMUSP00000053469
Gene: ENSMUSG00000036748

DomainStartEndE-ValueType
Pfam:CUE 144 183 4.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000096029
AA Change: M6K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126
AA Change: M6K

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167861
SMART Domains Protein: ENSMUSP00000129589
Gene: ENSMUSG00000036748

DomainStartEndE-ValueType
Pfam:CUE 144 183 5.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177667
SMART Domains Protein: ENSMUSP00000137489
Gene: ENSMUSG00000025226

DomainStartEndE-ValueType
Pfam:F-box 18 63 2.1e-6 PFAM
low complexity region 76 84 N/A INTRINSIC
LRR 113 138 1.01e1 SMART
LRR 139 164 1.89e-1 SMART
LRR 165 190 2.27e-4 SMART
LRR 192 217 3.47e0 SMART
LRR 218 243 2.57e-3 SMART
LRR 244 269 2.05e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000223903
AA Change: M6K
Predicted Effect unknown
Transcript: ENSMUST00000223917
AA Change: M6K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224444
Predicted Effect probably benign
Transcript: ENSMUST00000224447
AA Change: M6K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225072
Predicted Effect possibly damaging
Transcript: ENSMUST00000225323
AA Change: M6K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225770
Predicted Effect unknown
Transcript: ENSMUST00000225781
AA Change: M6K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Plekstrin homology and SEC7 domains-containing protein that functions as a guanine nucleotide exchange factor. The encoded protein regulates signal transduction by activating ADP-ribosylation factor 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,219,216 E1750K probably damaging Het
4933425L06Rik A G 13: 105,109,742 I270M probably benign Het
Aatk T C 11: 120,018,855 D28G probably benign Het
Abcg1 T A 17: 31,092,395 S125T probably damaging Het
Actbl2 T C 13: 111,256,183 S351P possibly damaging Het
Ankrd34b A G 13: 92,439,061 probably null Het
BC030867 T C 11: 102,255,296 Y133H possibly damaging Het
BC051665 C T 13: 60,782,654 V295I probably benign Het
C1qtnf2 A G 11: 43,491,156 N265S probably damaging Het
Ccdc14 C T 16: 34,721,850 R573* probably null Het
Cd55b A T 1: 130,409,875 Y247N probably damaging Het
Celsr2 A T 3: 108,413,591 V635E probably benign Het
Clec16a T C 16: 10,559,687 probably benign Het
Clec4b1 A G 6: 123,065,945 Y41C probably damaging Het
Cntn5 A T 9: 10,172,121 D19E probably benign Het
Cop1 A G 1: 159,232,805 N53S probably damaging Het
Csad A T 15: 102,188,667 M1K probably null Het
Cyb5rl A G 4: 107,080,945 I200V probably benign Het
Cyp26a1 A G 19: 37,698,342 T81A probably damaging Het
Cyp2d12 A T 15: 82,559,036 H433L probably benign Het
D7Ertd443e T A 7: 134,349,479 probably null Het
Dennd1b A G 1: 139,170,170 probably benign Het
Dmap1 G T 4: 117,675,298 T357K probably damaging Het
Dzip1 G T 14: 118,881,044 T759K probably benign Het
Elmo2 A G 2: 165,298,687 V300A probably damaging Het
Eml5 T C 12: 98,844,105 D864G possibly damaging Het
Ep400 A G 5: 110,668,645 V2670A probably damaging Het
Epha3 T A 16: 63,603,625 I534F probably damaging Het
Epha4 A C 1: 77,382,991 Y742D probably damaging Het
Ergic2 A G 6: 148,204,774 probably null Het
Ero1l A T 14: 45,299,088 probably null Het
Fam229a A G 4: 129,491,486 D70G probably damaging Het
Fbn2 C T 18: 58,093,359 R781Q probably damaging Het
Fbxo16 A T 14: 65,270,714 probably benign Het
Fbxo39 T A 11: 72,317,285 S154R probably benign Het
Fer T A 17: 63,991,580 probably null Het
Filip1l A G 16: 57,570,662 I538V possibly damaging Het
Filip1l A T 16: 57,571,047 D428V probably damaging Het
Fsip2 T C 2: 82,979,610 I2091T possibly damaging Het
Glyat A C 19: 12,651,398 T186P possibly damaging Het
Gm10604 A G 4: 11,980,083 S74P unknown Het
Gm4787 T G 12: 81,379,137 K82N possibly damaging Het
Hectd4 T C 5: 121,220,620 I50T unknown Het
Hectd4 T C 5: 121,263,967 S373P possibly damaging Het
Hmcn1 A T 1: 150,686,867 C2313* probably null Het
Igfn1 A T 1: 135,969,316 S1171T probably benign Het
Ints8 T C 4: 11,241,642 D267G probably benign Het
Itln1 A G 1: 171,529,159 C251R probably damaging Het
Jcad C T 18: 4,674,026 T596M probably damaging Het
Kcnj16 C T 11: 111,025,583 T357M probably benign Het
Kif13a G A 13: 46,814,200 T346M probably damaging Het
Klhl24 G A 16: 20,120,167 A491T probably benign Het
Kntc1 C T 5: 123,778,347 Q748* probably null Het
Krt25 T A 11: 99,317,296 K369* probably null Het
Krt75 C T 15: 101,568,031 R433Q probably benign Het
Krt76 A G 15: 101,884,858 F582L unknown Het
Lysmd1 G A 3: 95,138,397 V182I probably benign Het
Mab21l2 T A 3: 86,547,555 E46V probably damaging Het
Magi2 A T 5: 20,358,936 K355N probably damaging Het
March10 T C 11: 105,385,572 D630G probably damaging Het
Mast4 A T 13: 102,738,639 I1215N probably damaging Het
Nckap1 G A 2: 80,530,218 T523I probably benign Het
Nexmif T A X: 104,084,393 D1306V probably damaging Het
Nfkb1 A C 3: 135,589,329 I918R possibly damaging Het
Nup50 A T 15: 84,933,658 T93S probably benign Het
Nwd2 T C 5: 63,804,374 Y434H probably benign Het
Olfr61 T C 7: 140,638,484 V261A probably benign Het
Osbpl1a C A 18: 12,905,031 V288L probably benign Het
Pan3 A G 5: 147,527,036 E562G possibly damaging Het
Pappa T A 4: 65,180,889 Y548* probably null Het
Phf3 A T 1: 30,810,789 L1181Q probably damaging Het
Phip T C 9: 82,915,339 H537R possibly damaging Het
Pkhd1l1 T C 15: 44,485,428 I240T probably damaging Het
Pole G A 5: 110,290,502 probably null Het
Polq T A 16: 37,011,942 S15T unknown Het
Prrt2 T C 7: 127,020,224 E23G possibly damaging Het
Prss37 A T 6: 40,517,826 probably null Het
Prune2 T C 19: 17,000,036 L45P probably damaging Het
Psmd1 A G 1: 86,089,997 E510G possibly damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Pxdn T A 12: 30,003,406 I1194N probably damaging Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rgmb C A 17: 15,807,647 R270L probably benign Het
Rpgrip1l A G 8: 91,280,716 probably null Het
Rps2 G A 17: 24,720,379 probably benign Het
Rsbn1l G T 5: 20,902,366 A550E probably damaging Het
S1pr4 C T 10: 81,499,304 R112H probably benign Het
Scfd2 T C 5: 74,531,177 N148S probably damaging Het
Scin C T 12: 40,081,706 M276I probably benign Het
Sec24d T C 3: 123,353,606 I708T possibly damaging Het
Skint11 T A 4: 114,228,812 F41I possibly damaging Het
Slc15a4 A T 5: 127,617,239 F44Y possibly damaging Het
Slc6a18 A G 13: 73,675,806 Y72H probably benign Het
Slc7a11 A T 3: 50,377,746 probably null Het
Slc7a14 G T 3: 31,237,501 N209K possibly damaging Het
Sstr2 T C 11: 113,624,431 C59R probably damaging Het
Stab1 A G 14: 31,163,040 probably null Het
Stag1 G T 9: 100,866,210 S475I probably damaging Het
Stxbp5l A G 16: 37,115,667 Y1183H probably damaging Het
Svep1 A T 4: 58,135,628 probably null Het
Tm9sf2 A G 14: 122,158,684 T653A probably benign Het
Tmeff1 T C 4: 48,662,059 S366P possibly damaging Het
Tnnt2 G T 1: 135,852,065 W300L probably damaging Het
Traj32 A G 14: 54,186,103 probably benign Het
Trp53bp2 A T 1: 182,441,639 M223L probably benign Het
Tsga10 G A 1: 37,815,677 T246M probably damaging Het
Txn2 A T 15: 77,926,670 probably benign Het
Ubr3 T A 2: 69,938,198 F450I probably damaging Het
Usp47 T C 7: 112,104,470 probably null Het
Vars2 C T 17: 35,664,793 R244Q probably damaging Het
Xrra1 T A 7: 99,897,596 F251L probably damaging Het
Zfp804a G A 2: 82,257,519 R564Q probably benign Het
Zfp983 T C 17: 21,658,967 C29R probably damaging Het
Other mutations in Psd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Psd APN 19 46314747 missense possibly damaging 0.77
IGL01307:Psd APN 19 46314658 missense probably damaging 1.00
IGL02329:Psd APN 19 46319659 missense possibly damaging 0.66
IGL02423:Psd APN 19 46314504 missense possibly damaging 0.95
IGL02644:Psd APN 19 46323395 missense probably damaging 1.00
IGL02724:Psd APN 19 46319545 missense probably benign 0.04
IGL03117:Psd APN 19 46323122 unclassified probably benign
ANU05:Psd UTSW 19 46314747 missense possibly damaging 0.77
P0035:Psd UTSW 19 46320961 missense possibly damaging 0.56
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0054:Psd UTSW 19 46323342 missense probably damaging 1.00
R0403:Psd UTSW 19 46320972 unclassified probably benign
R0499:Psd UTSW 19 46322161 missense probably damaging 0.98
R0542:Psd UTSW 19 46314210 missense probably damaging 1.00
R0543:Psd UTSW 19 46319517 missense possibly damaging 0.62
R0894:Psd UTSW 19 46313441 missense probably damaging 1.00
R1449:Psd UTSW 19 46324811 missense probably damaging 0.99
R1586:Psd UTSW 19 46314798 missense probably damaging 0.98
R2096:Psd UTSW 19 46324649 unclassified probably null
R2857:Psd UTSW 19 46324420 missense probably benign 0.00
R2863:Psd UTSW 19 46314762 missense probably damaging 0.97
R3897:Psd UTSW 19 46324585 missense possibly damaging 0.93
R3967:Psd UTSW 19 46324406 missense probably benign
R3970:Psd UTSW 19 46324406 missense probably benign
R4435:Psd UTSW 19 46314494 missense probably damaging 1.00
R4612:Psd UTSW 19 46313339 missense probably benign 0.15
R4940:Psd UTSW 19 46322417 missense probably damaging 1.00
R5055:Psd UTSW 19 46322468 missense probably benign 0.00
R5485:Psd UTSW 19 46316089 splice site probably null
R5768:Psd UTSW 19 46312739 missense possibly damaging 0.84
R5775:Psd UTSW 19 46314772 nonsense probably null
R6057:Psd UTSW 19 46323314 missense possibly damaging 0.77
R6349:Psd UTSW 19 46313387 unclassified probably null
R6496:Psd UTSW 19 46320314 missense probably damaging 1.00
R6614:Psd UTSW 19 46313412 missense probably benign 0.11
R6820:Psd UTSW 19 46320844 missense probably damaging 1.00
R6849:Psd UTSW 19 46317746 missense probably damaging 0.97
R6860:Psd UTSW 19 46322419 missense probably damaging 1.00
R7286:Psd UTSW 19 46314801 missense probably damaging 0.98
R7326:Psd UTSW 19 46324454 missense probably benign 0.01
R7351:Psd UTSW 19 46322430 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTACAAGGTGCTGTCACACG -3'
(R):5'- CAGGATAGGTCTCTGGACTTTAG -3'

Sequencing Primer
(F):5'- GCTGTCACACGTCCCAGATC -3'
(R):5'- ATAGGTCTCTGGACTTTAGAAGGC -3'
Posted On2014-12-04