Incidental Mutation 'R2853:Fam214b'
ID252383
Institutional Source Beutler Lab
Gene Symbol Fam214b
Ensembl Gene ENSMUSG00000036002
Gene Namefamily with sequence similarity 214, member B
SynonymsB230312A22Rik
MMRRC Submission 040446-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.289) question?
Stock #R2853 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43032414-43046220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43036293 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 146 (L146P)
Ref Sequence ENSEMBL: ENSMUSP00000122882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030169] [ENSMUST00000036462] [ENSMUST00000107956] [ENSMUST00000107957] [ENSMUST00000107958] [ENSMUST00000107959] [ENSMUST00000124155] [ENSMUST00000135067] [ENSMUST00000136326] [ENSMUST00000138030] [ENSMUST00000144999] [ENSMUST00000152846]
Predicted Effect probably benign
Transcript: ENSMUST00000030169
SMART Domains Protein: ENSMUSP00000030169
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PHB 36 194 1.47e-57 SMART
coiled coil region 231 252 N/A INTRINSIC
Pfam:Band_7_C 259 321 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036462
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038177
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107956
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103590
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107957
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103591
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107958
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103592
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 479 537 8.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107959
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103593
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 327 345 N/A INTRINSIC
DUF4210 348 406 9.25e-30 SMART
Pfam:Chromosome_seg 480 537 8.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123465
Predicted Effect probably benign
Transcript: ENSMUST00000124155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127645
Predicted Effect probably benign
Transcript: ENSMUST00000135067
AA Change: L146P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122882
Gene: ENSMUSG00000036002
AA Change: L146P

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136326
SMART Domains Protein: ENSMUSP00000117586
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
PHB 1 148 1.33e-37 SMART
coiled coil region 185 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138030
SMART Domains Protein: ENSMUSP00000118465
Gene: ENSMUSG00000028455

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PHB 42 200 1.47e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140998
Predicted Effect probably benign
Transcript: ENSMUST00000144999
Predicted Effect probably benign
Transcript: ENSMUST00000152846
SMART Domains Protein: ENSMUSP00000118228
Gene: ENSMUSG00000036002

DomainStartEndE-ValueType
low complexity region 100 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180854
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A C 16: 8,600,968 K142T probably damaging Het
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Angptl7 T C 4: 148,500,279 E4G probably benign Het
Aph1c T C 9: 66,834,482 probably null Het
Arhgap23 T C 11: 97,492,594 probably null Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Chchd1 T C 14: 20,704,220 S67P probably benign Het
Cubn C T 2: 13,430,834 V1104I probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Ids G T X: 70,353,170 T329K probably damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Megf10 T C 18: 57,293,931 I1107T probably damaging Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mtm1 T G X: 71,301,783 I437S probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ncs1 T C 2: 31,287,317 F169L probably damaging Het
Ndst2 T C 14: 20,729,896 E92G probably damaging Het
Parm1 T C 5: 91,594,265 V164A probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Scgb1b20 A C 7: 33,373,524 K52N possibly damaging Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Sik2 A T 9: 50,898,297 L612Q probably damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Ss18l1 A G 2: 180,058,121 Y258C probably damaging Het
Togaram1 A G 12: 65,016,612 K1567R probably benign Het
Ttc6 T C 12: 57,576,181 F122S probably damaging Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 T C 4: 103,050,158 I644V possibly damaging Het
Other mutations in Fam214b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02268:Fam214b APN 4 43036468 nonsense probably null
IGL02810:Fam214b APN 4 43034429 missense probably damaging 1.00
PIT4431001:Fam214b UTSW 4 43036024 missense probably damaging 0.99
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0049:Fam214b UTSW 4 43036441 missense probably benign 0.30
R0565:Fam214b UTSW 4 43034647 unclassified probably benign
R0627:Fam214b UTSW 4 43036242 missense probably damaging 1.00
R1121:Fam214b UTSW 4 43034947 missense probably damaging 1.00
R2395:Fam214b UTSW 4 43035964 nonsense probably null
R3878:Fam214b UTSW 4 43035867 missense probably damaging 1.00
R4688:Fam214b UTSW 4 43034663 missense probably damaging 1.00
R6467:Fam214b UTSW 4 43033687 missense probably damaging 1.00
R6556:Fam214b UTSW 4 43033896 missense probably damaging 0.96
R7107:Fam214b UTSW 4 43036434 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CATTGGCAGTTCCATGGGAC -3'
(R):5'- GGGTCTACCAGGTATCCATCTTTTC -3'

Sequencing Primer
(F):5'- AGTTCCATGGGACTCCCTAG -3'
(R):5'- TTCAGCTGGTGCCTCCGAG -3'
Posted On2014-12-04