Incidental Mutation 'R2857:Gad2'
ID252447
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 22673975 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 397 (M397L)
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect probably benign
Transcript: ENSMUST00000028123
AA Change: M397L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: M397L

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1604:Gad2 UTSW 2 22623840 critical splice donor site probably null
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R3754:Gad2 UTSW 2 22681340 missense possibly damaging 0.91
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4382:Gad2 UTSW 2 22685410 missense probably benign
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4384:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R6675:Gad2 UTSW 2 22673985 missense possibly damaging 0.67
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCTCCCTGTGAACAATGG -3'
(R):5'- ACATGCAGATGAAGTCAAGGTC -3'

Sequencing Primer
(F):5'- CCTCCCTGTGAACAATGGAAGATG -3'
(R):5'- CAAGGTCTCAGTTCTGAAGGC -3'
Posted On2014-12-04