Incidental Mutation 'R2857:Nexn'
ID252457
Institutional Source Beutler Lab
Gene Symbol Nexn
Ensembl Gene ENSMUSG00000039103
Gene Namenexilin
Synonyms1110046H09Rik, nF actin binding protein
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152236982-152266350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152248043 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 247 (E247K)
Ref Sequence ENSEMBL: ENSMUSP00000142936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046045] [ENSMUST00000196504] [ENSMUST00000196815] [ENSMUST00000198460] [ENSMUST00000198648] [ENSMUST00000198750] [ENSMUST00000199423] [ENSMUST00000199470] [ENSMUST00000199685] [ENSMUST00000200589]
Predicted Effect probably damaging
Transcript: ENSMUST00000046045
AA Change: E183K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037120
Gene: ENSMUSG00000039103
AA Change: E183K

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
coiled coil region 176 358 N/A INTRINSIC
coiled coil region 391 419 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
low complexity region 487 493 N/A INTRINSIC
IG 519 603 4.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196504
SMART Domains Protein: ENSMUSP00000143180
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000196529
AA Change: E49K
Predicted Effect probably benign
Transcript: ENSMUST00000196815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198404
Predicted Effect probably damaging
Transcript: ENSMUST00000198460
AA Change: E233K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143573
Gene: ENSMUSG00000039103
AA Change: E233K

DomainStartEndE-ValueType
internal_repeat_1 14 35 1.01e-5 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 1.01e-5 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 345 N/A INTRINSIC
coiled coil region 378 406 N/A INTRINSIC
coiled coil region 429 480 N/A INTRINSIC
IG 506 590 2.1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198648
SMART Domains Protein: ENSMUSP00000143294
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198734
Predicted Effect probably damaging
Transcript: ENSMUST00000198750
AA Change: E169K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142574
Gene: ENSMUSG00000039103
AA Change: E169K

DomainStartEndE-ValueType
coiled coil region 40 86 N/A INTRINSIC
coiled coil region 162 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199423
AA Change: E247K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142936
Gene: ENSMUSG00000039103
AA Change: E247K

DomainStartEndE-ValueType
internal_repeat_1 14 35 4.74e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 4.74e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 240 422 N/A INTRINSIC
coiled coil region 455 483 N/A INTRINSIC
coiled coil region 506 557 N/A INTRINSIC
IG 583 667 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199470
SMART Domains Protein: ENSMUSP00000143133
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
internal_repeat_1 14 35 5.77e-6 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 5.77e-6 PROSPERO
low complexity region 108 131 N/A INTRINSIC
low complexity region 176 210 N/A INTRINSIC
low complexity region 248 259 N/A INTRINSIC
coiled coil region 321 349 N/A INTRINSIC
coiled coil region 372 423 N/A INTRINSIC
IG 449 533 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199685
SMART Domains Protein: ENSMUSP00000142569
Gene: ENSMUSG00000039103

DomainStartEndE-ValueType
coiled coil region 40 92 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199983
Predicted Effect probably damaging
Transcript: ENSMUST00000200589
AA Change: E233K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142559
Gene: ENSMUSG00000039103
AA Change: E233K

DomainStartEndE-ValueType
internal_repeat_1 14 35 8.44e-7 PROSPERO
low complexity region 36 53 N/A INTRINSIC
internal_repeat_1 86 106 8.44e-7 PROSPERO
low complexity region 108 131 N/A INTRINSIC
coiled coil region 226 333 N/A INTRINSIC
Meta Mutation Damage Score 0.416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality with endomyocardial fibroelastosis, cardiac hypertrophy and dilated cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Nexn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Nexn APN 3 152247233 missense probably benign 0.00
IGL01681:Nexn APN 3 152243870 missense possibly damaging 0.86
IGL02098:Nexn APN 3 152243903 nonsense probably null
IGL02146:Nexn APN 3 152247248 missense probably benign 0.01
IGL02151:Nexn APN 3 152248244 missense probably damaging 0.99
R0369:Nexn UTSW 3 152248257 missense probably benign 0.40
R0540:Nexn UTSW 3 152248242 nonsense probably null
R1501:Nexn UTSW 3 152237686 missense possibly damaging 0.91
R1828:Nexn UTSW 3 152242768 missense probably damaging 1.00
R1903:Nexn UTSW 3 152248181 missense probably damaging 0.99
R1990:Nexn UTSW 3 152252939 missense probably damaging 1.00
R2858:Nexn UTSW 3 152248043 missense probably damaging 1.00
R4482:Nexn UTSW 3 152242753 missense probably damaging 0.99
R4593:Nexn UTSW 3 152252916 missense probably damaging 1.00
R4750:Nexn UTSW 3 152237722 missense probably damaging 1.00
R5113:Nexn UTSW 3 152243888 missense probably damaging 1.00
R5252:Nexn UTSW 3 152237953 missense probably benign 0.01
R5289:Nexn UTSW 3 152248072 missense probably benign 0.13
R5502:Nexn UTSW 3 152238304 missense probably damaging 1.00
R5746:Nexn UTSW 3 152242876 unclassified probably benign
R6230:Nexn UTSW 3 152238275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATGAGGTAGCCCCATTTAG -3'
(R):5'- TGAAGAAGAGTGCCGAGTTCTC -3'

Sequencing Primer
(F):5'- CATTTAGAGAGACCGCCTTGG -3'
(R):5'- TGCCGAGTTCTCAAAGAAGC -3'
Posted On2014-12-04