Incidental Mutation 'R2857:Ehd2'
ID252472
Institutional Source Beutler Lab
Gene Symbol Ehd2
Ensembl Gene ENSMUSG00000074364
Gene NameEH-domain containing 2
SynonymsC130052H20Rik
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location15946958-15967567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15964129 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 61 (V61E)
Ref Sequence ENSEMBL: ENSMUSP00000096397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098799] [ENSMUST00000144956]
PDB Structure
Crystal structure of an EHD ATPase involved in membrane remodelling [X-RAY DIFFRACTION]
Structural insights into the N-terminus of the EHD2 ATPase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000098799
AA Change: V61E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364
AA Change: V61E

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 4.1e-19 PFAM
Pfam:MMR_HSR1 60 220 2.2e-7 PFAM
Pfam:Dynamin_N 61 221 2.4e-14 PFAM
EH 443 536 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144956
SMART Domains Protein: ENSMUSP00000119933
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:MMR_HSR1 4 84 2.4e-7 PFAM
Pfam:Dynamin_N 4 85 1.8e-10 PFAM
Meta Mutation Damage Score 0.69 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EH domain-containing protein family. These proteins are characterized by a C-terminal EF-hand domain, a nucleotide-binding consensus site at the N terminus and a bipartite nuclear localization signal. The encoded protein interacts with the actin cytoskeleton through an N-terminal domain and also binds to an EH domain-binding protein through the C-terminal EH domain. This interaction appears to connect clathrin-dependent endocytosis to actin, suggesting that this gene product participates in the endocytic pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Ehd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ehd2 APN 7 15963467 missense possibly damaging 0.89
IGL03117:Ehd2 APN 7 15950471 missense possibly damaging 0.81
R0485:Ehd2 UTSW 7 15952076 missense probably benign 0.07
R1858:Ehd2 UTSW 7 15952188 missense probably benign 0.00
R2151:Ehd2 UTSW 7 15952203 missense probably damaging 0.96
R2859:Ehd2 UTSW 7 15964129 missense probably damaging 1.00
R5965:Ehd2 UTSW 7 15952074 missense possibly damaging 0.94
R6175:Ehd2 UTSW 7 15963464 nonsense probably null
R6562:Ehd2 UTSW 7 15957567 missense probably benign 0.04
R6874:Ehd2 UTSW 7 15950438 missense probably benign 0.23
Z1088:Ehd2 UTSW 7 15963466 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAAAAGGGTTGAGTTTGCGG -3'
(R):5'- CATCGAAAGTCACCATGTTCAG -3'

Sequencing Primer
(F):5'- AAGGGCTTCTCTGGGTCCAC -3'
(R):5'- GAAAGTCACCATGTTCAGCTGGC -3'
Posted On2014-12-04