Incidental Mutation 'R2857:Prc1'
ID252477
Institutional Source Beutler Lab
Gene Symbol Prc1
Ensembl Gene ENSMUSG00000038943
Gene Nameprotein regulator of cytokinesis 1
SynonymsD7Ertd348e
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80294450-80316259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80312221 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 52 (N52S)
Ref Sequence ENSEMBL: ENSMUSP00000133618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047362] [ENSMUST00000047558] [ENSMUST00000121882] [ENSMUST00000163812] [ENSMUST00000172781] [ENSMUST00000173824] [ENSMUST00000174172] [ENSMUST00000174199]
Predicted Effect probably benign
Transcript: ENSMUST00000047362
SMART Domains Protein: ENSMUSP00000048043
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 2.9e-17 PFAM
Pfam:RCC1_2 215 244 1.3e-10 PFAM
Pfam:RCC1 231 316 7.8e-9 PFAM
Pfam:RCC1_2 303 332 3.3e-10 PFAM
Pfam:RCC1 319 370 4.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047558
AA Change: N486S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043379
Gene: ENSMUSG00000038943
AA Change: N486S

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.45e-5 PROSPERO
Pfam:MAP65_ASE1 37 602 5.3e-172 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121882
SMART Domains Protein: ENSMUSP00000113273
Gene: ENSMUSG00000038930

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:RCC1 179 228 7.4e-18 PFAM
Pfam:RCC1_2 216 244 5.5e-10 PFAM
Pfam:RCC1_2 304 332 6.2e-10 PFAM
Pfam:RCC1 319 370 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148001
Predicted Effect probably benign
Transcript: ENSMUST00000163812
AA Change: N489S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129675
Gene: ENSMUSG00000038943
AA Change: N489S

DomainStartEndE-ValueType
internal_repeat_1 22 36 1.51e-5 PROSPERO
Pfam:MAP65_ASE1 37 605 1.9e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172781
AA Change: N52S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133618
Gene: ENSMUSG00000038943
AA Change: N52S

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 150 2.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172911
Predicted Effect probably benign
Transcript: ENSMUST00000173170
SMART Domains Protein: ENSMUSP00000133817
Gene: ENSMUSG00000038943

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 189 2.1e-64 PFAM
Pfam:MAP65_ASE1 187 235 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173824
AA Change: N489S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000133910
Gene: ENSMUSG00000038943
AA Change: N489S

DomainStartEndE-ValueType
internal_repeat_1 22 36 8.71e-6 PROSPERO
Pfam:MAP65_ASE1 37 565 6e-168 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174051
AA Change: N118S
SMART Domains Protein: ENSMUSP00000134262
Gene: ENSMUSG00000038943
AA Change: N118S

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 1 244 1.9e-55 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174111
AA Change: N27S
Predicted Effect probably benign
Transcript: ENSMUST00000174172
AA Change: N489S

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133387
Gene: ENSMUSG00000038943
AA Change: N489S

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 34 615 2.9e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174199
AA Change: N448S

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133295
Gene: ENSMUSG00000038943
AA Change: N448S

DomainStartEndE-ValueType
Pfam:MAP65_ASE1 7 524 8.1e-158 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174599
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in cytokinesis. The protein is present at high levels during the S and G2/M phases of mitosis but its levels drop dramatically when the cell exits mitosis and enters the G1 phase. It is located in the nucleus during interphase, becomes associated with mitotic spindles in a highly dynamic manner during mitosis, and localizes to the cell mid-body during cytokinesis. This protein has been shown to be a substrate of several cyclin-dependent kinases (CDKs). It is necessary for polarizing parallel microtubules and concentrating the factors responsible for contractile ring assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Prc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Prc1 APN 7 80307696 critical splice donor site probably null
IGL02342:Prc1 APN 7 80309442 missense probably damaging 1.00
IGL03058:Prc1 APN 7 80301125 missense probably benign 0.05
R0026:Prc1 UTSW 7 80311061 unclassified probably benign
R0315:Prc1 UTSW 7 80313536 missense probably damaging 0.99
R0453:Prc1 UTSW 7 80313102 missense probably damaging 1.00
R2101:Prc1 UTSW 7 80312284 missense probably benign 0.38
R4237:Prc1 UTSW 7 80311216 unclassified probably benign
R4238:Prc1 UTSW 7 80311216 unclassified probably benign
R4240:Prc1 UTSW 7 80311216 unclassified probably benign
R4300:Prc1 UTSW 7 80311216 unclassified probably benign
R4745:Prc1 UTSW 7 80313163 missense probably benign 0.10
R5227:Prc1 UTSW 7 80313179 missense probably damaging 1.00
R5574:Prc1 UTSW 7 80294542 unclassified probably benign
R6174:Prc1 UTSW 7 80304796 missense probably benign 0.02
R6269:Prc1 UTSW 7 80309427 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAAGTTTATAGTGCCATCAGGTG -3'
(R):5'- CCAGCCTAATTCTCAGATTCTCAAG -3'

Sequencing Primer
(F):5'- CCATCAGGTGGCTCTGAAAC -3'
(R):5'- AGCCATGATCATAGAAACTAGACTG -3'
Posted On2014-12-04