Incidental Mutation 'R2857:Mau2'
ID252485
Institutional Source Beutler Lab
Gene Symbol Mau2
Ensembl Gene ENSMUSG00000031858
Gene NameMAU2 sister chromatid cohesion factor
Synonyms
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70016123-70042734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70019824 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 570 (M570V)
Ref Sequence ENSEMBL: ENSMUSP00000148479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050561] [ENSMUST00000168013] [ENSMUST00000212308] [ENSMUST00000212451] [ENSMUST00000212845]
Predicted Effect probably benign
Transcript: ENSMUST00000050561
AA Change: M569V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000054763
Gene: ENSMUSG00000031858
AA Change: M569V

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 575 5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168013
AA Change: M570V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000131966
Gene: ENSMUSG00000031858
AA Change: M570V

DomainStartEndE-ValueType
Pfam:Cohesin_load 29 576 8.7e-130 PFAM
Pfam:TPR_8 71 105 3.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212055
Predicted Effect probably benign
Transcript: ENSMUST00000212308
AA Change: M570V

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212401
Predicted Effect probably benign
Transcript: ENSMUST00000212451
AA Change: M570V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000212845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Mau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Mau2 APN 8 70029245 splice site probably benign
IGL02353:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02360:Mau2 APN 8 70019638 missense probably damaging 0.99
IGL02990:Mau2 APN 8 70022255 splice site probably benign
R0378:Mau2 UTSW 8 70030655 missense probably damaging 0.99
R0556:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0558:Mau2 UTSW 8 70042432 missense probably damaging 1.00
R0731:Mau2 UTSW 8 70023612 critical splice donor site probably null
R0987:Mau2 UTSW 8 70027698 missense probably damaging 0.99
R1866:Mau2 UTSW 8 70031492 missense probably damaging 1.00
R4852:Mau2 UTSW 8 70033177 critical splice donor site probably null
R4893:Mau2 UTSW 8 70030640 critical splice donor site probably null
R4970:Mau2 UTSW 8 70027703 missense possibly damaging 0.94
R5004:Mau2 UTSW 8 70025887 missense probably damaging 1.00
R5012:Mau2 UTSW 8 70031457 splice site probably null
R5248:Mau2 UTSW 8 70028723 missense probably benign 0.11
R6150:Mau2 UTSW 8 70019837 missense probably benign 0.23
R6178:Mau2 UTSW 8 70042537 missense probably damaging 0.96
R6343:Mau2 UTSW 8 70031523 missense probably damaging 0.99
R6649:Mau2 UTSW 8 70031516 missense possibly damaging 0.71
R6838:Mau2 UTSW 8 70039297 splice site probably null
R6959:Mau2 UTSW 8 70033228 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTGGAACTGCACAG -3'
(R):5'- TTAAGAACTCTGGCAGGTGGAG -3'

Sequencing Primer
(F):5'- GGGTGGGCCATCTGTCCAC -3'
(R):5'- AGACTGGGTTCCTGCTCAG -3'
Posted On2014-12-04