Incidental Mutation 'R2857:Amfr'
ID252488
Institutional Source Beutler Lab
Gene Symbol Amfr
Ensembl Gene ENSMUSG00000031751
Gene Nameautocrine motility factor receptor
Synonymsgp78
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93971588-94012842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94005214 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 11 (N11K)
Ref Sequence ENSEMBL: ENSMUSP00000134924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053766] [ENSMUST00000143265]
Predicted Effect probably damaging
Transcript: ENSMUST00000053766
AA Change: N85K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052258
Gene: ENSMUSG00000031751
AA Change: N85K

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 141 158 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
RING 337 374 1.14e-8 SMART
CUE 452 493 3.3e-11 SMART
PDB:4LAD|B 571 596 2e-7 PDB
low complexity region 620 637 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143265
AA Change: N11K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134924
Gene: ENSMUSG00000031751
AA Change: N11K

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 68 87 N/A INTRINSIC
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a glycosylated transmembrane receptor. Its ligand, autocrine motility factor, is a tumor motility-stimulating protein secreted by tumor cells. The encoded receptor is also a member of the E3 ubiquitin ligase family of proteins. It catalyzes ubiquitination and endoplasmic reticulum-associated degradation of specific proteins. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice for a gene-trapped null allele are obese and develop liver steatosis and/or hepatic inflammation resembling nonalcoholic steatohepatitis. Some mice develop liver tumors. Mice homozygous for another knock-out allele exhibit normal HMGCR turnover in mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Amfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Amfr APN 8 93987508 critical splice acceptor site probably null
IGL02169:Amfr APN 8 94005230 splice site probably null
IGL03218:Amfr APN 8 94000336 missense probably damaging 0.97
FR4449:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4737:Amfr UTSW 8 94005159 missense probably damaging 1.00
FR4976:Amfr UTSW 8 94012292 unclassified probably benign
R0344:Amfr UTSW 8 93987370 splice site probably null
R0532:Amfr UTSW 8 93999108 missense probably damaging 1.00
R1056:Amfr UTSW 8 93985469 missense probably benign 0.27
R1295:Amfr UTSW 8 93974804 missense probably benign 0.26
R1386:Amfr UTSW 8 93985399 missense possibly damaging 0.58
R1450:Amfr UTSW 8 93987747 missense probably benign 0.45
R1613:Amfr UTSW 8 93999226 missense probably benign 0.00
R1703:Amfr UTSW 8 93974243 missense probably benign
R2858:Amfr UTSW 8 94005214 missense probably damaging 1.00
R2859:Amfr UTSW 8 94005214 missense probably damaging 1.00
R3109:Amfr UTSW 8 94000306 missense probably damaging 1.00
R3708:Amfr UTSW 8 93983320 missense probably benign 0.05
R4456:Amfr UTSW 8 93984940 missense possibly damaging 0.80
R4600:Amfr UTSW 8 93974221 missense probably damaging 0.99
R4952:Amfr UTSW 8 93973159 unclassified probably benign
R5261:Amfr UTSW 8 93976170 critical splice acceptor site probably null
R5391:Amfr UTSW 8 93976048 missense probably damaging 1.00
R5788:Amfr UTSW 8 94000314 missense probably damaging 1.00
R6238:Amfr UTSW 8 94000364 missense probably damaging 1.00
R6584:Amfr UTSW 8 93974155 missense probably benign 0.00
R6795:Amfr UTSW 8 94000333 missense probably benign 0.09
R6955:Amfr UTSW 8 94000376 missense probably damaging 1.00
R6978:Amfr UTSW 8 94000387 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGTCCAGATGTGCACAC -3'
(R):5'- GGGTCTGACTCAATGAGCTTTTC -3'

Sequencing Primer
(F):5'- CATGACTCTGGATGAAATACATGC -3'
(R):5'- AATGAGCTTTTCCGCCCCATG -3'
Posted On2014-12-04