Incidental Mutation 'R2857:Sycp3'
ID252499
Institutional Source Beutler Lab
Gene Symbol Sycp3
Ensembl Gene ENSMUSG00000020059
Gene Namesynaptonemal complex protein 3
SynonymsScp3, Cor1
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location88459569-88473236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88467372 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 166 (E166G)
Ref Sequence ENSEMBL: ENSMUSP00000137800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020252] [ENSMUST00000117440] [ENSMUST00000123244] [ENSMUST00000125612] [ENSMUST00000148899]
Predicted Effect probably damaging
Transcript: ENSMUST00000020252
AA Change: E166G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020252
Gene: ENSMUSG00000020059
AA Change: E166G

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 101 229 6.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117440
SMART Domains Protein: ENSMUSP00000112708
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:CDP-OH_P_transf 61 136 8.8e-18 PFAM
transmembrane domain 159 181 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 263 282 N/A INTRINSIC
transmembrane domain 295 317 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123244
SMART Domains Protein: ENSMUSP00000137704
Gene: ENSMUSG00000020059

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125612
AA Change: E166G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137800
Gene: ENSMUSG00000020059
AA Change: E166G

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 100 229 7.6e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134318
SMART Domains Protein: ENSMUSP00000122428
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148899
SMART Domains Protein: ENSMUSP00000120167
Gene: ENSMUSG00000060002

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential structural component of the synaptonemal complex. This complex is involved in synapsis, recombination and segregation of meiotic chromosomes. Mutations in this gene are associated with azoospermia in males and susceptibility to pregnancy loss in females. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutants are male infertile and female sub-fertile. Reduced litter size in females is due to achiasmatic oocytes, resulting in aneuploidy and embryonic death. Meiosis in males blocks at early prophase with lack of synaptonemal complexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Sycp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sycp3 APN 10 88466472 missense possibly damaging 0.65
IGL02402:Sycp3 APN 10 88466563 intron probably benign
R1468:Sycp3 UTSW 10 88469592 missense possibly damaging 0.75
R1468:Sycp3 UTSW 10 88469592 missense possibly damaging 0.75
R2858:Sycp3 UTSW 10 88467372 missense probably damaging 1.00
R2897:Sycp3 UTSW 10 88472682 missense possibly damaging 0.92
R2898:Sycp3 UTSW 10 88472682 missense possibly damaging 0.92
R4194:Sycp3 UTSW 10 88463375 missense probably benign 0.01
R5683:Sycp3 UTSW 10 88472935 missense probably damaging 1.00
R6882:Sycp3 UTSW 10 88472929 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGTGAGAAGACATCTGTTAAG -3'
(R):5'- ATGTACCTATACTTCTGGGGTTTACC -3'

Sequencing Primer
(F):5'- GAAATTTGACAGGATTCACTGT -3'
(R):5'- ATACTTCTGGGGTTTACCATTTGGC -3'
Posted On2014-12-04