Incidental Mutation 'R2857:Stat2'
ID252504
Institutional Source Beutler Lab
Gene Symbol Stat2
Ensembl Gene ENSMUSG00000040033
Gene Namesignal transducer and activator of transcription 2
Synonyms1600010G07Rik
MMRRC Submission 040447-MU
Accession Numbers

Genbank: NM_019963.1; Ensembl: ENSMUST00000085708

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128270559-128292849 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 128276901 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085708] [ENSMUST00000105238]
Predicted Effect probably null
Transcript: ENSMUST00000085708
SMART Domains Protein: ENSMUSP00000082855
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 138 314 5e-52 PFAM
Pfam:STAT_bind 316 564 1.2e-96 PFAM
SH2 576 652 4.71e-6 SMART
internal_repeat_1 750 778 6.35e-10 PROSPERO
internal_repeat_1 822 850 6.35e-10 PROSPERO
Pfam:STAT2_C 853 907 1.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105238
SMART Domains Protein: ENSMUSP00000100872
Gene: ENSMUSG00000040033

DomainStartEndE-ValueType
STAT_int 2 124 4.49e-54 SMART
Pfam:STAT_alpha 141 314 2.6e-49 PFAM
Pfam:STAT_bind 316 564 1.5e-67 PFAM
SH2 577 653 4.71e-6 SMART
internal_repeat_1 751 779 6.69e-10 PROSPERO
internal_repeat_1 823 851 6.69e-10 PROSPERO
Pfam:STAT2_C 854 908 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220142
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. In response to interferon (IFN), this protein forms a complex with STAT1 and IFN regulatory factor family protein p48 (ISGF3G), in which this protein acts as a transactivator, but lacks the ability to bind DNA directly. Transcription adaptor P300/CBP (EP300/CREBBP) has been shown to interact specifically with this protein, which is thought to be involved in the process of blocking IFN-alpha response by adenovirus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Immune response is impaired in homozygous null mice. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4) Chemically induced(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Stat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Stat2 APN 10 128281176 missense probably benign 0.42
IGL02528:Stat2 APN 10 128290665 missense probably benign 0.07
IGL02859:Stat2 APN 10 128276611 missense probably damaging 1.00
IGL03119:Stat2 APN 10 128283517 missense probably benign 0.15
numb UTSW 10 128281065 intron probably null
1mM(1):Stat2 UTSW 10 128277723 missense probably benign 0.06
R0098:Stat2 UTSW 10 128283262 missense probably damaging 1.00
R0334:Stat2 UTSW 10 128277867 missense probably damaging 1.00
R0496:Stat2 UTSW 10 128276509 missense probably benign 0.04
R1478:Stat2 UTSW 10 128282100 critical splice acceptor site probably null
R3698:Stat2 UTSW 10 128278793 missense probably benign 0.30
R3870:Stat2 UTSW 10 128277893 missense probably benign 0.17
R5231:Stat2 UTSW 10 128281242 critical splice donor site probably null
R5235:Stat2 UTSW 10 128291032 critical splice donor site probably null
R5264:Stat2 UTSW 10 128281065 intron probably null
R5855:Stat2 UTSW 10 128283494 missense probably damaging 1.00
R6752:Stat2 UTSW 10 128283753 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTTTGAGATCTCAGAGC -3'
(R):5'- TACCTTAGTGACCTGCCAATC -3'

Sequencing Primer
(F):5'- GGTAGTTCACAGAGCTCTTGTCAC -3'
(R):5'- TTAGTGACCTGCCAATCCAGAC -3'
Posted On2014-12-04