Incidental Mutation 'R2857:Fam71b'
ID252507
Institutional Source Beutler Lab
Gene Symbol Fam71b
Ensembl Gene ENSMUSG00000020401
Gene Namefamily with sequence similarity 71, member B
SynonymsOTTMUSG00000005491
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46396559-46407982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46405212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 137 (I137T)
Ref Sequence ENSEMBL: ENSMUSP00000055079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063166]
Predicted Effect probably damaging
Transcript: ENSMUST00000063166
AA Change: I137T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055079
Gene: ENSMUSG00000020401
AA Change: I137T

DomainStartEndE-ValueType
Pfam:DUF3699 120 192 1.2e-32 PFAM
low complexity region 241 361 N/A INTRINSIC
low complexity region 497 523 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
SCOP:d1g7sa3 586 650 1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139280
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Fam71b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Fam71b APN 11 46405397 nonsense probably null
IGL02375:Fam71b APN 11 46406552 missense probably damaging 0.99
IGL02571:Fam71b APN 11 46405245 missense probably damaging 0.99
R0013:Fam71b UTSW 11 46406804 missense unknown
R1902:Fam71b UTSW 11 46407011 missense probably benign 0.44
R1985:Fam71b UTSW 11 46407866 makesense probably null
R2079:Fam71b UTSW 11 46405107 missense probably benign 0.14
R2151:Fam71b UTSW 11 46405331 nonsense probably null
R2859:Fam71b UTSW 11 46405212 missense probably damaging 1.00
R3807:Fam71b UTSW 11 46404953 missense possibly damaging 0.77
R4232:Fam71b UTSW 11 46407405 missense possibly damaging 0.51
R4342:Fam71b UTSW 11 46407216 missense possibly damaging 0.67
R4679:Fam71b UTSW 11 46404813 missense possibly damaging 0.68
R5119:Fam71b UTSW 11 46407036 missense probably damaging 1.00
R5207:Fam71b UTSW 11 46405163 missense probably benign 0.13
R5540:Fam71b UTSW 11 46404888 missense probably damaging 0.99
R6618:Fam71b UTSW 11 46407299 missense probably damaging 1.00
R6862:Fam71b UTSW 11 46407591 missense possibly damaging 0.78
Z1088:Fam71b UTSW 11 46407723 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATGGTGACTGTGTGCATCGC -3'
(R):5'- TACAAGTGTGCTTTTGGTGTCAAC -3'

Sequencing Primer
(F):5'- GTGTGCATCGCATCTACCAG -3'
(R):5'- AACGCTTGTCTCGCCAGTG -3'
Posted On2014-12-04