Incidental Mutation 'R2857:Olfr311'
ID252509
Institutional Source Beutler Lab
Gene Symbol Olfr311
Ensembl Gene ENSMUSG00000094805
Gene Nameolfactory receptor 311
SynonymsMOR222-1, GA_x6K02T2NKPP-565870-564944
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58839251-58844111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58841882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 256 (V256E)
Ref Sequence ENSEMBL: ENSMUSP00000150870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071625] [ENSMUST00000216473]
Predicted Effect probably benign
Transcript: ENSMUST00000071625
AA Change: V256E

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071553
Gene: ENSMUSG00000094805
AA Change: V256E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 9e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 215 1.7e-8 PFAM
Pfam:7tm_1 39 288 9.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214776
Predicted Effect probably benign
Transcript: ENSMUST00000216473
AA Change: V256E

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Olfr311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Olfr311 APN 11 58841512 missense probably benign 0.10
H8786:Olfr311 UTSW 11 58841320 missense probably benign 0.22
R0620:Olfr311 UTSW 11 58841443 missense probably damaging 1.00
R0671:Olfr311 UTSW 11 58841855 missense possibly damaging 0.94
R0827:Olfr311 UTSW 11 58841771 missense probably damaging 1.00
R0839:Olfr311 UTSW 11 58841652 missense probably benign
R0932:Olfr311 UTSW 11 58841714 missense possibly damaging 0.92
R1117:Olfr311 UTSW 11 58841815 missense possibly damaging 0.64
R1533:Olfr311 UTSW 11 58841966 missense probably damaging 1.00
R1540:Olfr311 UTSW 11 58841651 missense probably benign 0.01
R1595:Olfr311 UTSW 11 58841652 missense probably benign
R1826:Olfr311 UTSW 11 58841431 missense probably benign
R2858:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R2859:Olfr311 UTSW 11 58841882 missense probably benign 0.42
R3438:Olfr311 UTSW 11 58841872 nonsense probably null
R3765:Olfr311 UTSW 11 58841294 missense probably damaging 1.00
R3831:Olfr311 UTSW 11 58841860 missense probably damaging 0.99
R4858:Olfr311 UTSW 11 58841207 missense possibly damaging 0.86
R5651:Olfr311 UTSW 11 58841491 nonsense probably null
R5979:Olfr311 UTSW 11 58841840 missense probably damaging 1.00
R6316:Olfr311 UTSW 11 58841942 missense probably damaging 1.00
R6717:Olfr311 UTSW 11 58841287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGTCCTGCACTGATTACC -3'
(R):5'- CCACACACTGTAGGCTTCAATG -3'

Sequencing Primer
(F):5'- CTGCACTGATTACCATCTCAATGAGG -3'
(R):5'- CACTGTAGGCTTCAATGTCTCAATAC -3'
Posted On2014-12-04