Incidental Mutation 'R2857:Riok1'
ID252515
Institutional Source Beutler Lab
Gene Symbol Riok1
Ensembl Gene ENSMUSG00000021428
Gene NameRIO kinase 1
Synonyms
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R2857 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38036995-38061433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38049077 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 229 (F229L)
Ref Sequence ENSEMBL: ENSMUSP00000021866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021866] [ENSMUST00000223656] [ENSMUST00000224477]
Predicted Effect probably damaging
Transcript: ENSMUST00000021866
AA Change: F229L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021866
Gene: ENSMUSG00000021428
AA Change: F229L

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
RIO 150 386 5.1e-134 SMART
Blast:RIO 465 531 4e-12 BLAST
low complexity region 551 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223910
Predicted Effect probably benign
Transcript: ENSMUST00000224477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224683
Predicted Effect unknown
Transcript: ENSMUST00000224956
AA Change: F173L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226056
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Riok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Riok1 APN 13 38059956 missense possibly damaging 0.80
IGL02675:Riok1 APN 13 38050243 missense probably damaging 0.99
IGL02892:Riok1 APN 13 38040065 splice site probably benign
IGL02952:Riok1 APN 13 38048890 missense probably damaging 1.00
IGL03386:Riok1 APN 13 38057237 nonsense probably null
IGL03054:Riok1 UTSW 13 38047315 missense probably damaging 1.00
R0959:Riok1 UTSW 13 38057173 missense probably damaging 0.96
R1423:Riok1 UTSW 13 38049114 missense probably damaging 1.00
R1558:Riok1 UTSW 13 38050855 missense probably damaging 1.00
R1624:Riok1 UTSW 13 38037511 missense probably damaging 1.00
R1717:Riok1 UTSW 13 38052950 missense probably damaging 1.00
R1858:Riok1 UTSW 13 38058718 nonsense probably null
R1920:Riok1 UTSW 13 38057201 missense probably benign 0.27
R4179:Riok1 UTSW 13 38048955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATACTATGCTAGCACACCCAG -3'
(R):5'- TGCAGGCTCTTCACAATAGC -3'

Sequencing Primer
(F):5'- CACACCCAGTGGAGAGAGC -3'
(R):5'- GCTACATAGTCTAAAGGGTCCC -3'
Posted On2014-12-04