Incidental Mutation 'R2857:Olfr743'
ID252517
Institutional Source Beutler Lab
Gene Symbol Olfr743
Ensembl Gene ENSMUSG00000094285
Gene Nameolfactory receptor 743
SynonymsOlfr264, GA_x6K02T2PMLR-6243196-6244132, MOR106-8P, GA_x6K02T2N6FY-3870-3385, GA_x6K02T2N6FY-2320-2039, MOR106-14, Olfr265, Olfr743-ps1
MMRRC Submission 040447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R2857 (G1)
Quality Score210
Status Not validated
Chromosome14
Chromosomal Location50521839-50534955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50533440 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 9 (N9K)
Ref Sequence ENSEMBL: ENSMUSP00000150946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071294] [ENSMUST00000215793]
Predicted Effect probably benign
Transcript: ENSMUST00000071294
AA Change: N9K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071263
Gene: ENSMUSG00000094285
AA Change: N9K

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 1.6e-56 PFAM
Pfam:7tm_1 45 294 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215793
AA Change: N9K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A330087D11Rik A T 7: 29,573,878 noncoding transcript Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Bpifa6 G A 2: 153,989,274 M253I probably benign Het
C330018D20Rik A G 18: 56,962,459 L18P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cfap54 C T 10: 93,045,282 R348Q probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Erich5 C T 15: 34,471,414 T263I probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Gad2 A C 2: 22,673,975 M397L probably benign Het
Gm5724 A G 6: 141,744,538 V163A probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Kcnh8 A G 17: 52,977,933 D977G probably benign Het
Maats1 A C 16: 38,302,713 L651R probably damaging Het
Mau2 T C 8: 70,019,824 M570V probably benign Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Phrf1 T A 7: 141,259,680 probably benign Het
Prc1 A G 7: 80,312,221 N52S probably damaging Het
Psd G C 19: 46,324,420 S170R probably benign Het
Riok1 T C 13: 38,049,077 F229L probably damaging Het
Stat2 A G 10: 128,276,901 probably null Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Szt2 G A 4: 118,369,402 T510I probably damaging Het
Trank1 A T 9: 111,366,933 T1342S probably benign Het
Trav3-1 C A 14: 52,581,058 A63E probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Trmt11 G C 10: 30,547,748 P387R probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Wdfy3 A T 5: 101,875,930 I2451N probably benign Het
Zfp326 G A 5: 105,888,529 R102H probably benign Het
Other mutations in Olfr743
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Olfr743 APN 14 50533949 missense probably damaging 1.00
IGL01551:Olfr743 APN 14 50534161 missense probably benign
IGL02024:Olfr743 APN 14 50533850 missense probably benign 0.00
IGL02867:Olfr743 APN 14 50533513 missense probably benign
IGL02889:Olfr743 APN 14 50533513 missense probably benign
IGL03195:Olfr743 APN 14 50533420 missense probably benign
IGL03296:Olfr743 APN 14 50533945 missense possibly damaging 0.90
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0049:Olfr743 UTSW 14 50533694 missense probably damaging 1.00
R0102:Olfr743 UTSW 14 50533631 missense probably damaging 1.00
R0556:Olfr743 UTSW 14 50533924 missense probably benign 0.01
R0626:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0661:Olfr743 UTSW 14 50534095 missense probably benign
R0759:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0761:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R0894:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1109:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1110:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1312:Olfr743 UTSW 14 50534195 missense probably benign
R1446:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1470:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1502:Olfr743 UTSW 14 50533777 missense possibly damaging 0.47
R1518:Olfr743 UTSW 14 50534165 missense probably damaging 1.00
R1529:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1624:Olfr743 UTSW 14 50533643 missense probably damaging 1.00
R1646:Olfr743 UTSW 14 50533583 missense probably benign 0.01
R1687:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R1795:Olfr743 UTSW 14 50533702 missense possibly damaging 0.78
R2011:Olfr743 UTSW 14 50533684 missense probably damaging 1.00
R2120:Olfr743 UTSW 14 50533946 missense probably damaging 1.00
R2697:Olfr743 UTSW 14 50533781 missense probably damaging 1.00
R2858:Olfr743 UTSW 14 50533440 missense probably benign 0.19
R3906:Olfr743 UTSW 14 50533754 missense probably benign 0.03
R4327:Olfr743 UTSW 14 50533514 missense probably benign 0.05
R4355:Olfr743 UTSW 14 50533759 missense possibly damaging 0.94
R4663:Olfr743 UTSW 14 50533604 missense probably damaging 1.00
R5214:Olfr743 UTSW 14 50534347 makesense probably null
R5964:Olfr743 UTSW 14 50534198 missense probably damaging 0.99
R6148:Olfr743 UTSW 14 50534321 missense probably benign 0.00
R6167:Olfr743 UTSW 14 50534155 missense probably damaging 1.00
R6301:Olfr743 UTSW 14 50534254 missense probably benign 0.02
R6616:Olfr743 UTSW 14 50533907 missense probably benign 0.43
R6910:Olfr743 UTSW 14 50533873 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CATTGCTGAATATCCAGTGCTTG -3'
(R):5'- GACATACCAGATTTCCAGGAAGG -3'

Sequencing Primer
(F):5'- GGGCAAAAATTAAACTCCCTC -3'
(R):5'- AGTTGGCCAGCAGGAGGTAC -3'
Posted On2014-12-04