Incidental Mutation 'R2571:Mmp3'
ID252547
Institutional Source Beutler Lab
Gene Symbol Mmp3
Ensembl Gene ENSMUSG00000043613
Gene Namematrix metallopeptidase 3
SynonymsStmy1, Str1, stromelysin 1, SLN-1, stromelysin-1, STR-1, progelatinase, SLN1
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7445822-7455975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7451844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 394 (I394N)
Ref Sequence ENSEMBL: ENSMUSP00000034497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034497
AA Change: I394N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034497
Gene: ENSMUSG00000043613
AA Change: I394N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:PG_binding_1 29 89 1.7e-12 PFAM
ZnMc 107 267 6.24e-65 SMART
HX 298 340 4.56e-9 SMART
HX 342 385 2.87e-6 SMART
HX 390 437 4.73e-16 SMART
HX 439 479 3.3e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded protein is activated by the removal of an N-temrinal activation peptide to generate a zinc-dependent endopeptidase with a broad range of substrates such as proteoglycans, laminin, fibronectin, elastin, and collagens. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for disrutptions in this gene display abnormalities of the immune system as well as minor structural abnormalities in the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Mmp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Mmp3 APN 9 7445894 utr 5 prime probably benign
IGL01738:Mmp3 APN 9 7446946 missense possibly damaging 0.94
IGL02154:Mmp3 APN 9 7453662 missense probably benign 0.19
IGL02212:Mmp3 APN 9 7450165 missense probably damaging 1.00
IGL02568:Mmp3 APN 9 7446001 missense probably benign 0.02
IGL03366:Mmp3 APN 9 7450149 missense probably benign 0.00
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0047:Mmp3 UTSW 9 7451910 splice site probably benign
R0356:Mmp3 UTSW 9 7451768 missense probably benign 0.03
R0390:Mmp3 UTSW 9 7451320 missense probably benign 0.29
R0401:Mmp3 UTSW 9 7449790 missense probably damaging 1.00
R0466:Mmp3 UTSW 9 7450165 missense probably damaging 1.00
R0549:Mmp3 UTSW 9 7455638 missense probably benign 0.08
R0903:Mmp3 UTSW 9 7445994 missense probably benign 0.00
R1438:Mmp3 UTSW 9 7453705 missense probably benign 0.22
R1498:Mmp3 UTSW 9 7446967 missense possibly damaging 0.95
R1515:Mmp3 UTSW 9 7451232 missense probably benign 0.01
R1629:Mmp3 UTSW 9 7447641 missense probably benign 0.00
R1844:Mmp3 UTSW 9 7453662 missense probably benign 0.19
R1858:Mmp3 UTSW 9 7451799 missense probably benign 0.08
R2099:Mmp3 UTSW 9 7453672 missense probably benign 0.01
R2497:Mmp3 UTSW 9 7450131 missense probably benign 0.00
R4659:Mmp3 UTSW 9 7453673 missense probably benign 0.00
R4687:Mmp3 UTSW 9 7451223 missense probably benign 0.03
R4717:Mmp3 UTSW 9 7449881 missense possibly damaging 0.94
R4930:Mmp3 UTSW 9 7447640 missense probably benign 0.02
R4932:Mmp3 UTSW 9 7446994 missense probably benign 0.00
R5020:Mmp3 UTSW 9 7445984 missense probably benign
R5384:Mmp3 UTSW 9 7451759 nonsense probably null
R5385:Mmp3 UTSW 9 7451759 nonsense probably null
R5408:Mmp3 UTSW 9 7449904 missense probably damaging 0.98
R6268:Mmp3 UTSW 9 7447622 missense possibly damaging 0.78
X0022:Mmp3 UTSW 9 7449857 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CGCAAGCCATAATTCCTGGAC -3'
(R):5'- AGAGAAGATGGCCTCTCAGC -3'

Sequencing Primer
(F):5'- CCTGGACTTTTTAACACGATGG -3'
(R):5'- CCTACTTTACTGAATAGGAAGGAGC -3'
Posted On2014-12-04