Incidental Mutation 'R2858:5430403G16Rik'
ID252556
Institutional Source Beutler Lab
Gene Symbol 5430403G16Rik
Ensembl Gene ENSMUSG00000072763
Gene NameRIKEN cDNA 5430403G16 gene
SynonymsENSMUSG00000072763
MMRRC Submission 040448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R2858 (G1)
Quality Score209
Status Validated
Chromosome5
Chromosomal Location109674545-109691041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109675953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000090395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092720]
Predicted Effect probably benign
Transcript: ENSMUST00000092720
AA Change: T544A

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000090395
Gene: ENSMUSG00000072763
AA Change: T544A

DomainStartEndE-ValueType
KRAB 4 60 2.47e-14 SMART
ZnF_C2H2 131 153 3.39e-3 SMART
ZnF_C2H2 159 181 3.95e-4 SMART
ZnF_C2H2 187 209 3.95e-4 SMART
ZnF_C2H2 215 237 1.12e-3 SMART
ZnF_C2H2 243 265 4.01e-5 SMART
ZnF_C2H2 271 293 7.78e-3 SMART
ZnF_C2H2 299 321 2.61e-4 SMART
ZnF_C2H2 327 349 1.36e-2 SMART
ZnF_C2H2 355 377 7.37e-4 SMART
ZnF_C2H2 383 405 1.3e-4 SMART
ZnF_C2H2 411 433 3.69e-4 SMART
ZnF_C2H2 439 461 4.3e-5 SMART
ZnF_C2H2 467 489 2.57e-3 SMART
ZnF_C2H2 495 517 2.61e-4 SMART
ZnF_C2H2 523 545 2.05e-2 SMART
ZnF_C2H2 551 573 5.59e-4 SMART
ZnF_C2H2 579 601 1.58e-3 SMART
ZnF_C2H2 607 629 9.08e-4 SMART
ZnF_C2H2 635 657 3.44e-4 SMART
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T A 5: 107,545,801 F95I probably benign Het
Abcg5 A G 17: 84,670,220 probably null Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Chd4 A G 6: 125,104,886 K481R probably damaging Het
Cyp2a22 T C 7: 26,934,262 Y341C probably damaging Het
Ddb2 T C 2: 91,216,677 T338A probably damaging Het
Fat2 A G 11: 55,283,773 V2038A possibly damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Helz G A 11: 107,672,927 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ifit1bl1 A T 19: 34,594,322 I245K probably benign Het
Ighv1-22 T C 12: 114,746,298 D109G probably damaging Het
Kcnk10 T C 12: 98,435,289 R376G possibly damaging Het
Lrrc66 T A 5: 73,607,303 E799V probably benign Het
Lrrc7 T A 3: 158,161,725 N793I probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Polq T A 16: 37,062,753 F1760I possibly damaging Het
Ppp1r1b T C 11: 98,355,319 probably benign Het
Psmf1 A G 2: 151,729,536 L169P probably damaging Het
Rcbtb1 T A 14: 59,221,412 probably null Het
S1pr4 C A 10: 81,499,239 A134S probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a1 T C 9: 64,949,332 I98V unknown Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Uhrf1bp1 G T 17: 27,885,462 R494L probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Other mutations in 5430403G16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:5430403G16Rik APN 5 109677316 nonsense probably null
IGL02547:5430403G16Rik APN 5 109678762 critical splice donor site probably null
IGL02589:5430403G16Rik APN 5 109678520 missense possibly damaging 0.95
R0363:5430403G16Rik UTSW 5 109676888 missense probably benign 0.03
R0628:5430403G16Rik UTSW 5 109678576 critical splice acceptor site probably null
R4914:5430403G16Rik UTSW 5 109678530 missense probably damaging 1.00
R4945:5430403G16Rik UTSW 5 109677075 missense possibly damaging 0.60
R5444:5430403G16Rik UTSW 5 109675636 nonsense probably null
R6000:5430403G16Rik UTSW 5 109676864 missense probably benign 0.19
R6258:5430403G16Rik UTSW 5 109676567 missense probably benign 0.01
R6389:5430403G16Rik UTSW 5 109676019 missense possibly damaging 0.84
R6945:5430403G16Rik UTSW 5 109676845 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATATGTAAAGGCTTTACCACACTGAT -3'
(R):5'- GCCTTTGCCTCTCATGGTCAA -3'

Sequencing Primer
(F):5'- GCAAAGGCTTTACCACATTGATC -3'
(R):5'- GGTAAAGCCTTTGCCTTTCATAG -3'
Posted On2014-12-04