Incidental Mutation 'R2571:Sos2'
ID252573
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69635718 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 242 (E242V)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000035773
AA Change: E242V

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: E242V

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182396
AA Change: E242V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: E242V

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183277
AA Change: E242V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: E242V

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTTAGTGACAGTTTAAAGTGG -3'
(R):5'- AAGCTGTCTGACTAACGCCTTC -3'

Sequencing Primer
(F):5'- AAGTGGTTCTATATACTTACCTCTGC -3'
(R):5'- CTCTATCCTGGGGTCACAGATG -3'
Posted On2014-12-04