Incidental Mutation 'R2858:Abcg5'
ID252601
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 040448-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2858 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84670220 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect probably null
Transcript: ENSMUST00000066175
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172439
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T A 5: 107,545,801 F95I probably benign Het
5430403G16Rik T C 5: 109,675,953 T544A probably benign Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Chd4 A G 6: 125,104,886 K481R probably damaging Het
Cyp2a22 T C 7: 26,934,262 Y341C probably damaging Het
Ddb2 T C 2: 91,216,677 T338A probably damaging Het
Fat2 A G 11: 55,283,773 V2038A possibly damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Helz G A 11: 107,672,927 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ifit1bl1 A T 19: 34,594,322 I245K probably benign Het
Ighv1-22 T C 12: 114,746,298 D109G probably damaging Het
Kcnk10 T C 12: 98,435,289 R376G possibly damaging Het
Lrrc66 T A 5: 73,607,303 E799V probably benign Het
Lrrc7 T A 3: 158,161,725 N793I probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Polq T A 16: 37,062,753 F1760I possibly damaging Het
Ppp1r1b T C 11: 98,355,319 probably benign Het
Psmf1 A G 2: 151,729,536 L169P probably damaging Het
Rcbtb1 T A 14: 59,221,412 probably null Het
S1pr4 C A 10: 81,499,239 A134S probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a1 T C 9: 64,949,332 I98V unknown Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Uhrf1bp1 G T 17: 27,885,462 R494L probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2121:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2124:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R4963:Abcg5 UTSW 17 84660141 nonsense probably null
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5348:Abcg5 UTSW 17 84671206 missense possibly damaging 0.92
R5445:Abcg5 UTSW 17 84671129 missense probably damaging 1.00
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTTCTGGACGCGGAGAAG -3'
(R):5'- TGACATCAGTGGACACCCAAAG -3'

Sequencing Primer
(F):5'- ATGAGGAAGAGGCCCATGATC -3'
(R):5'- TCAGTGGACACCCAAAGCAGAG -3'
Posted On2014-12-04