Incidental Mutation 'R2655:Pnpla7'
ID252626
Institutional Source Beutler Lab
Gene Symbol Pnpla7
Ensembl Gene ENSMUSG00000036833
Gene Namepatatin-like phospholipase domain containing 7
SynonymsNRE, E430013P11Rik
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24976033-25054057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25052318 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 83 (Y83C)
Ref Sequence ENSEMBL: ENSMUSP00000115952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006646] [ENSMUST00000045295] [ENSMUST00000074422] [ENSMUST00000100334] [ENSMUST00000102931] [ENSMUST00000114386] [ENSMUST00000114388] [ENSMUST00000116574] [ENSMUST00000132172] [ENSMUST00000137913] [ENSMUST00000140737] [ENSMUST00000144520] [ENSMUST00000152122] [ENSMUST00000155601]
Predicted Effect probably benign
Transcript: ENSMUST00000006646
SMART Domains Protein: ENSMUSP00000006646
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 361 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045295
AA Change: Y1216C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044078
Gene: ENSMUSG00000036833
AA Change: Y1216C

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
low complexity region 59 66 N/A INTRINSIC
cNMP 170 295 2.06e-12 SMART
low complexity region 439 444 N/A INTRINSIC
cNMP 481 600 1.16e-6 SMART
cNMP 603 716 1.55e-7 SMART
Pfam:Patatin 950 1116 3.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074422
SMART Domains Protein: ENSMUSP00000074022
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100334
SMART Domains Protein: ENSMUSP00000097908
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
low complexity region 363 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102931
SMART Domains Protein: ENSMUSP00000099995
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114386
SMART Domains Protein: ENSMUSP00000110028
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 310 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114388
SMART Domains Protein: ENSMUSP00000110030
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 331 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116574
SMART Domains Protein: ENSMUSP00000112273
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132082
Predicted Effect probably benign
Transcript: ENSMUST00000132172
SMART Domains Protein: ENSMUSP00000116106
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134744
SMART Domains Protein: ENSMUSP00000120376
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135328
Predicted Effect probably benign
Transcript: ENSMUST00000137913
SMART Domains Protein: ENSMUSP00000141577
Gene: ENSMUSG00000036833

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
low complexity region 33 40 N/A INTRINSIC
Pfam:cNMP_binding 162 200 2.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138536
Predicted Effect probably benign
Transcript: ENSMUST00000140737
SMART Domains Protein: ENSMUSP00000141410
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141866
Predicted Effect probably benign
Transcript: ENSMUST00000144520
SMART Domains Protein: ENSMUSP00000141583
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152122
SMART Domains Protein: ENSMUSP00000121580
Gene: ENSMUSG00000006476

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:IQ 62 80 2.5e-4 PFAM
low complexity region 114 125 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154359
Predicted Effect probably damaging
Transcript: ENSMUST00000155601
AA Change: Y83C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175104
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human patatin-like phospholipases, such as PNPLA7, have been implicated in regulation of adipocyte differentiation and have been induced by metabolic stimuli (Wilson et al., 2006 [PubMed 16799181]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Pnpla7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pnpla7 APN 2 24976315 critical splice donor site probably null
IGL00765:Pnpla7 APN 2 24980224 missense probably damaging 0.98
IGL01576:Pnpla7 APN 2 25016563 missense probably damaging 1.00
IGL01626:Pnpla7 APN 2 25050893 missense possibly damaging 0.58
IGL01844:Pnpla7 APN 2 25050973 critical splice donor site probably null
IGL02280:Pnpla7 APN 2 25011577 missense probably benign 0.00
IGL02629:Pnpla7 APN 2 25050945 missense probably damaging 1.00
IGL02642:Pnpla7 APN 2 25050276 missense probably benign 0.24
IGL02931:Pnpla7 APN 2 25015229 missense possibly damaging 0.87
IGL03162:Pnpla7 APN 2 25015289 unclassified probably benign
PIT4495001:Pnpla7 UTSW 2 25042139 missense probably damaging 0.99
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0047:Pnpla7 UTSW 2 25011606 missense probably damaging 1.00
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0064:Pnpla7 UTSW 2 24997227 nonsense probably null
R0309:Pnpla7 UTSW 2 24987195 missense probably damaging 1.00
R0541:Pnpla7 UTSW 2 24995293 missense probably damaging 0.99
R0556:Pnpla7 UTSW 2 25052301 splice site probably null
R0565:Pnpla7 UTSW 2 24980117 splice site probably benign
R0830:Pnpla7 UTSW 2 24997255 missense probably damaging 1.00
R0865:Pnpla7 UTSW 2 24982123 missense probably benign 0.34
R0893:Pnpla7 UTSW 2 24997240 missense probably damaging 1.00
R0969:Pnpla7 UTSW 2 25050953 missense probably damaging 1.00
R1102:Pnpla7 UTSW 2 24996165 missense probably damaging 1.00
R1551:Pnpla7 UTSW 2 25047708 missense probably benign 0.01
R1572:Pnpla7 UTSW 2 25015251 missense possibly damaging 0.69
R1623:Pnpla7 UTSW 2 25052599 missense probably damaging 1.00
R1876:Pnpla7 UTSW 2 25040973 missense possibly damaging 0.91
R1898:Pnpla7 UTSW 2 25053784 unclassified probably benign
R1909:Pnpla7 UTSW 2 24997288 missense possibly damaging 0.75
R1973:Pnpla7 UTSW 2 25016617 missense probably damaging 1.00
R2230:Pnpla7 UTSW 2 25051598 unclassified probably benign
R2381:Pnpla7 UTSW 2 24980758 missense probably damaging 1.00
R3125:Pnpla7 UTSW 2 25042138 missense probably damaging 1.00
R4223:Pnpla7 UTSW 2 24982114 missense possibly damaging 0.69
R4411:Pnpla7 UTSW 2 25051704 nonsense probably null
R4573:Pnpla7 UTSW 2 25050873 missense probably damaging 0.98
R4674:Pnpla7 UTSW 2 25052317 missense probably damaging 1.00
R4841:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4842:Pnpla7 UTSW 2 24980052 missense probably benign 0.05
R4893:Pnpla7 UTSW 2 25053676 nonsense probably null
R4941:Pnpla7 UTSW 2 24997264 unclassified probably null
R5116:Pnpla7 UTSW 2 25021970 missense probably damaging 0.97
R5126:Pnpla7 UTSW 2 24980044 missense possibly damaging 0.83
R5138:Pnpla7 UTSW 2 25041103 missense possibly damaging 0.88
R5169:Pnpla7 UTSW 2 25050309 missense probably benign 0.03
R5188:Pnpla7 UTSW 2 24997300 missense probably benign 0.06
R5288:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5307:Pnpla7 UTSW 2 25021952 missense possibly damaging 0.81
R5339:Pnpla7 UTSW 2 25002937 missense probably benign 0.10
R5384:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5385:Pnpla7 UTSW 2 25041019 missense probably damaging 0.97
R5479:Pnpla7 UTSW 2 25019441 missense possibly damaging 0.90
R5640:Pnpla7 UTSW 2 25003001 missense possibly damaging 0.92
R5662:Pnpla7 UTSW 2 25052384 missense probably damaging 1.00
R5751:Pnpla7 UTSW 2 24981778 missense probably damaging 0.97
R5874:Pnpla7 UTSW 2 25011649 missense probably benign
R6284:Pnpla7 UTSW 2 25016618 missense possibly damaging 0.79
R6351:Pnpla7 UTSW 2 25011564 missense probably damaging 0.97
R6513:Pnpla7 UTSW 2 25016538 missense possibly damaging 0.62
R7193:Pnpla7 UTSW 2 25051615 missense probably damaging 1.00
R7503:Pnpla7 UTSW 2 24983532 nonsense probably null
R7526:Pnpla7 UTSW 2 24998666 missense not run
Predicted Primers PCR Primer
(F):5'- ACTACTGTGAGTACCTGAGGCC -3'
(R):5'- TGGCACATCACCTGTCTCAG -3'

Sequencing Primer
(F):5'- GAGGCCTCCCATCGACAGTTAC -3'
(R):5'- TGTCTCAGGCTACACACCCG -3'
Posted On2014-12-04