Incidental Mutation 'R2655:Igfbpl1'
ID252638
Institutional Source Beutler Lab
Gene Symbol Igfbpl1
Ensembl Gene ENSMUSG00000035551
Gene Nameinsulin-like growth factor binding protein-like 1
SynonymsIGFBP-like protein, 2810453O06Rik, 2810011G06Rik
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45809468-45826923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45816289 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000036974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044297]
Predicted Effect probably damaging
Transcript: ENSMUST00000044297
AA Change: T179A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036974
Gene: ENSMUSG00000035551
AA Change: T179A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IB 28 100 1.31e-3 SMART
KAZAL 82 143 6.59e-14 SMART
IGc2 159 242 5.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145102
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Igfbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Igfbpl1 APN 4 45826478 missense probably damaging 0.99
IGL03339:Igfbpl1 APN 4 45813555 splice site probably benign
PIT1430001:Igfbpl1 UTSW 4 45826756 missense unknown
PIT4504001:Igfbpl1 UTSW 4 45813469 missense possibly damaging 0.86
R1824:Igfbpl1 UTSW 4 45826406 missense probably benign 0.19
R3850:Igfbpl1 UTSW 4 45826426 missense probably benign 0.02
R5431:Igfbpl1 UTSW 4 45815588 missense probably benign 0.21
R5695:Igfbpl1 UTSW 4 45826374 missense probably damaging 1.00
R6229:Igfbpl1 UTSW 4 45813517 missense probably damaging 1.00
R6613:Igfbpl1 UTSW 4 45813447 missense probably benign 0.00
R6950:Igfbpl1 UTSW 4 45815494 missense probably damaging 1.00
R6954:Igfbpl1 UTSW 4 45826663 missense probably damaging 1.00
R6971:Igfbpl1 UTSW 4 45816333 missense possibly damaging 0.72
R7558:Igfbpl1 UTSW 4 45813497 missense not run
Predicted Primers PCR Primer
(F):5'- GTTTTGAGACACAGCGCTGG -3'
(R):5'- TGACCACTGGAAATGGCTTTTC -3'

Sequencing Primer
(F):5'- TTTGAGACACAGCGCTGGAGTATC -3'
(R):5'- TCCATTATCATCAAGGTGGGAGC -3'
Posted On2014-12-04