Incidental Mutation 'R2859:Ehd2'
ID252639
Institutional Source Beutler Lab
Gene Symbol Ehd2
Ensembl Gene ENSMUSG00000074364
Gene NameEH-domain containing 2
SynonymsC130052H20Rik
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R2859 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location15946958-15967567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15964129 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 61 (V61E)
Ref Sequence ENSEMBL: ENSMUSP00000096397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098799] [ENSMUST00000144956]
PDB Structure
Crystal structure of an EHD ATPase involved in membrane remodelling [X-RAY DIFFRACTION]
Structural insights into the N-terminus of the EHD2 ATPase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000098799
AA Change: V61E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364
AA Change: V61E

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 4.1e-19 PFAM
Pfam:MMR_HSR1 60 220 2.2e-7 PFAM
Pfam:Dynamin_N 61 221 2.4e-14 PFAM
EH 443 536 2.96e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144956
SMART Domains Protein: ENSMUSP00000119933
Gene: ENSMUSG00000074364

DomainStartEndE-ValueType
Pfam:MMR_HSR1 4 84 2.4e-7 PFAM
Pfam:Dynamin_N 4 85 1.8e-10 PFAM
Meta Mutation Damage Score 0.69 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EH domain-containing protein family. These proteins are characterized by a C-terminal EF-hand domain, a nucleotide-binding consensus site at the N terminus and a bipartite nuclear localization signal. The encoded protein interacts with the actin cytoskeleton through an N-terminal domain and also binds to an EH domain-binding protein through the C-terminal EH domain. This interaction appears to connect clathrin-dependent endocytosis to actin, suggesting that this gene product participates in the endocytic pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Ehd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ehd2 APN 7 15963467 missense possibly damaging 0.89
IGL03117:Ehd2 APN 7 15950471 missense possibly damaging 0.81
R0485:Ehd2 UTSW 7 15952076 missense probably benign 0.07
R1858:Ehd2 UTSW 7 15952188 missense probably benign 0.00
R2151:Ehd2 UTSW 7 15952203 missense probably damaging 0.96
R2857:Ehd2 UTSW 7 15964129 missense probably damaging 1.00
R5965:Ehd2 UTSW 7 15952074 missense possibly damaging 0.94
R6175:Ehd2 UTSW 7 15963464 nonsense probably null
R6562:Ehd2 UTSW 7 15957567 missense probably benign 0.04
R6874:Ehd2 UTSW 7 15950438 missense probably benign 0.23
Z1088:Ehd2 UTSW 7 15963466 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCAAAAGGGTTGAGTTTGCG -3'
(R):5'- CATCGAAAGTCACCATGTTCAGC -3'

Sequencing Primer
(F):5'- AAGGGCTTCTCTGGGTCCAC -3'
(R):5'- ACCATGTTCAGCTGGCTG -3'
Posted On2014-12-04